ID: 1057628563

View in Genome Browser
Species Human (GRCh38)
Location 9:96700858-96700880
Sequence GCTGCCTGCCAGTCCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057628562_1057628563 -6 Left 1057628562 9:96700841-96700863 CCGGGGCTGCAGGTGGAGCTGCC 0: 480
1: 298
2: 198
3: 186
4: 717
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data
1057628557_1057628563 10 Left 1057628557 9:96700825-96700847 CCTAGTGGATCCCACACCGGGGC 0: 57
1: 370
2: 636
3: 546
4: 397
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data
1057628561_1057628563 -1 Left 1057628561 9:96700836-96700858 CCACACCGGGGCTGCAGGTGGAG 0: 249
1: 456
2: 284
3: 205
4: 385
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data
1057628552_1057628563 24 Left 1057628552 9:96700811-96700833 CCCAGCTGGCTTCACCTAGTGGA 0: 373
1: 1084
2: 559
3: 192
4: 145
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data
1057628553_1057628563 23 Left 1057628553 9:96700812-96700834 CCAGCTGGCTTCACCTAGTGGAT 0: 383
1: 1104
2: 562
3: 193
4: 142
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data
1057628560_1057628563 0 Left 1057628560 9:96700835-96700857 CCCACACCGGGGCTGCAGGTGGA 0: 48
1: 348
2: 500
3: 353
4: 371
Right 1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057628563 Original CRISPR GCTGCCTGCCAGTCCCGCGC CGG Intergenic
No off target data available for this crispr