ID: 1057630803

View in Genome Browser
Species Human (GRCh38)
Location 9:96717582-96717604
Sequence ATGCTTATGTAGGTGGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057630803_1057630808 27 Left 1057630803 9:96717582-96717604 CCGTGCCCCACCTACATAAGCAT No data
Right 1057630808 9:96717632-96717654 TGAGACAGAGTCTTGCTGTGTGG 0: 12
1: 348
2: 1033
3: 2342
4: 2947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057630803 Original CRISPR ATGCTTATGTAGGTGGGGCA CGG (reversed) Intergenic
No off target data available for this crispr