ID: 1057641780

View in Genome Browser
Species Human (GRCh38)
Location 9:96830583-96830605
Sequence CTGTGGCAGGGGAGGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 12, 3: 78, 4: 859}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057641780 Original CRISPR CTGTGGCAGGGGAGGTTGGG GGG (reversed) Intronic
900095267 1:937615-937637 CTCTGGCACGGGAGGCTGTGGGG + Intronic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900277219 1:1838685-1838707 CTTTGGGAGGTCAGGTTGGGTGG - Intronic
900316885 1:2061396-2061418 TGGAGGAAGGGGAGGTTGGGGGG + Intronic
900495386 1:2973791-2973813 CTGTGGCCGGGAGGTTTGGGGGG - Intergenic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
901068111 1:6504253-6504275 GTGTGGCAGCTGATGTTGGGGGG - Intronic
901578704 1:10222360-10222382 CTGAGACAGGGGAGGTAGGTTGG + Intronic
901666778 1:10830634-10830656 CTGGGGCAGGGGGCGCTGGGGGG + Intergenic
901707852 1:11089719-11089741 CTTTGGGAGGGCAGGTTGGGAGG + Intronic
901789635 1:11647565-11647587 CTGGGGGAGGGGAGGTGGGGAGG - Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902288604 1:15422473-15422495 CTGGGGCGGCGGAGGTGGGGGGG - Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902379458 1:16045763-16045785 CAGGTGCAGCGGAGGTTGGGGGG + Intronic
902609525 1:17588896-17588918 GTGTAGTGGGGGAGGTTGGGGGG + Intronic
902901528 1:19519778-19519800 CTTTGGGAGGCCAGGTTGGGAGG - Intergenic
903033943 1:20482351-20482373 CTTTGGCTGGGGGGGTGGGGTGG - Intergenic
903063621 1:20686233-20686255 GACAGGCAGGGGAGGTTGGGGGG - Intronic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904255937 1:29255007-29255029 CTGAGCCAGTGGTGGTTGGGGGG + Intronic
904433394 1:30479381-30479403 CTGTAGCGGGAGAGGTTGAGAGG - Intergenic
904434784 1:30487339-30487361 CTGGGGCAGGACAGGATGGGAGG - Intergenic
904541758 1:31238522-31238544 CCCTGGCAGGGGAATTTGGGAGG - Intronic
904625830 1:31801544-31801566 CTGGGGGAGGGCAGGCTGGGTGG + Intronic
904676262 1:32201029-32201051 CTGGGACTGGGGGGGTTGGGGGG - Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905225140 1:36473851-36473873 ATGAGGCAGGAGAGGTTGTGGGG + Exonic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
905357561 1:37395369-37395391 CTGTGGCTGGTGAGGTGGAGGGG - Intergenic
905389036 1:37624470-37624492 CTGAGGGAGGTGGGGTTGGGGGG - Intronic
905944329 1:41889239-41889261 GTGTAGCAGGGGATGTGGGGTGG - Intronic
906207488 1:43994988-43995010 CTGAGGAAGGACAGGTTGGGTGG + Intronic
906465898 1:46078962-46078984 CTGAGGGAGGGGAGAATGGGGGG + Intronic
906694865 1:47817206-47817228 CTGGGGCAGGGGTGTTGGGGGGG - Intronic
907037710 1:51230840-51230862 CTGTGGCTGGGCACTTTGGGAGG + Intergenic
907452329 1:54553753-54553775 CAGAGGCAGGGGTTGTTGGGGGG - Intronic
907526162 1:55055316-55055338 GAGTGGCGGGGGAAGTTGGGTGG + Intronic
908768176 1:67572598-67572620 CTGTGAAATGGGAGTTTGGGAGG + Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
912401271 1:109395829-109395851 CTGTGGCAGGCTAAGGTGGGTGG + Intronic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912665770 1:111578199-111578221 CGGTGGAAGGGGAGGATTGGTGG + Intronic
913017464 1:114753672-114753694 CTGTGGCAGGCCAAGGTGGGAGG + Intronic
913616485 1:120565083-120565105 CTGAGGCAGGGGTGGTTTAGTGG + Intergenic
914225502 1:145716670-145716692 AGGAAGCAGGGGAGGTTGGGAGG - Intergenic
914573792 1:148945828-148945850 CTGAGGCAGGGGTGGTTTAGTGG - Intronic
914752574 1:150545615-150545637 GTGTGGGAGGGGAGCCTGGGAGG - Intergenic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915309374 1:154999664-154999686 CGGAGGCAGCGGAGGATGGGGGG + Intergenic
915341405 1:155178741-155178763 GTGTGGCAGGGTGGGCTGGGTGG - Intronic
915361414 1:155288279-155288301 CTGAGGCAGAGAGGGTTGGGAGG - Exonic
915505955 1:156356699-156356721 CTGTGGGAGGCCAAGTTGGGAGG - Intronic
915511929 1:156391254-156391276 CCCTGCCAGGGGAGGGTGGGTGG + Intergenic
915597051 1:156901860-156901882 CTGGAGCAGGGCAGGGTGGGAGG + Intronic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
916275408 1:162988481-162988503 CTGTGGCGGGGGACGATGAGTGG - Intergenic
917232418 1:172852531-172852553 CGGTGGGGTGGGAGGTTGGGGGG - Intergenic
917485689 1:175452592-175452614 CTGTAGCCTGGGAAGTTGGGGGG + Intronic
917568837 1:176242055-176242077 TTCTTGCAGGGCAGGTTGGGTGG + Intergenic
917875762 1:179285489-179285511 CTTTGGGAGGCTAGGTTGGGAGG + Intergenic
917875882 1:179286534-179286556 CTTTGGGAGGCTAGGTTGGGTGG - Intergenic
919542719 1:198871506-198871528 TTGTGGGATGGGAGGTGGGGAGG - Intergenic
919658570 1:200221389-200221411 ATGTGGCAGTAGAGGTTGTGGGG - Intergenic
919742572 1:200989789-200989811 CTGTGGCATGGGAGGTGCAGAGG + Intronic
919904507 1:202068821-202068843 CAGTCCCAGGGGAGTTTGGGTGG + Intergenic
919922334 1:202174080-202174102 CTGGGGCTGGGGAGGATGGGTGG + Intergenic
920075670 1:203334693-203334715 CTGTGCCAGGGCGGGGTGGGGGG + Intergenic
920202711 1:204269564-204269586 CAGAGGCAGGGGAGGTCGGGGGG - Intronic
920343571 1:205291603-205291625 CTTTGGGAGGCCAGGTTGGGTGG + Intergenic
920377846 1:205518912-205518934 AGGTGGGAGGGGAGGTTGGCTGG + Intronic
921070931 1:211656949-211656971 CATGGGAAGGGGAGGTTGGGTGG - Intergenic
921233298 1:213096443-213096465 CTTTGGGAGGGCAGGGTGGGTGG + Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
923016250 1:230128620-230128642 CGGGGGCGGGGGTGGTTGGGGGG + Intronic
923707697 1:236358112-236358134 CTTTGGGAGGTGAAGTTGGGTGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924608016 1:245551827-245551849 CTGGGGTTGGGGAGGTTGGCAGG - Intronic
924608083 1:245552213-245552235 CTGTGACTGTGGAGGTTGGCGGG + Intronic
1062843123 10:686451-686473 GTGTGGGTGGGGAGGTTGTGCGG - Intronic
1064265382 10:13821277-13821299 CTGTGGCAGGGGACACAGGGAGG + Intronic
1064577456 10:16760743-16760765 CAGTGACAGTGGAGGTGGGGGGG - Intronic
1065287995 10:24203555-24203577 CTGTGGAGGTGGGGGTTGGGGGG - Intronic
1065419402 10:25525650-25525672 CTGTGGCAGGGGAAGAATGGGGG + Intronic
1065559408 10:26946754-26946776 GTGGGGCAGGGGAGCTTTGGGGG - Intergenic
1065628410 10:27653997-27654019 TTATGTCAGGGGAGGCTGGGTGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067057232 10:43059284-43059306 CTGTGACAGGGCAGGTGGTGGGG - Intergenic
1067065073 10:43099703-43099725 CTGTGGCAGGCGGGGGTGTGGGG - Intronic
1067250885 10:44586460-44586482 GTGTGGCAAGGGAGGGAGGGTGG + Intergenic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1068684995 10:59860949-59860971 CTTTGGGAGGGCAAGTTGGGTGG + Intronic
1068685205 10:59863546-59863568 TTGGGGCAGGGAAGGGTGGGTGG + Intronic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1069639290 10:69944410-69944432 CTCTGGGAGGCCAGGTTGGGAGG + Intronic
1069718314 10:70534547-70534569 CTGGGGCAGGGGTGGTGGAGGGG + Intronic
1069747286 10:70723827-70723849 CTGTGGCAGGGTGGCTGGGGTGG - Intronic
1069756597 10:70777506-70777528 CTAGGGCAGGTGAGGTTGGGGGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070961922 10:80505382-80505404 CTGTGGCAGGGGTGCTGGGGAGG + Intronic
1071124830 10:82321289-82321311 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
1071481601 10:86069069-86069091 CTGGGGAAGGTTAGGTTGGGAGG + Intronic
1071858215 10:89646670-89646692 ATGAGGCAGGAGAGGTAGGGAGG - Intergenic
1074057078 10:109932250-109932272 CTGTGACTGGGGAGGATGGGAGG - Intergenic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1075447609 10:122524752-122524774 CACTGGCAGGGCAGGTCGGGAGG - Intergenic
1075721726 10:124591368-124591390 CCATGGCAGGGGAGGTGGTGGGG - Intronic
1075916412 10:126171383-126171405 CCGTGGCAGGGGTGGTTAGTTGG + Intronic
1076338663 10:129727965-129727987 CTGGAGCAGGGGAGGGTGTGAGG + Intronic
1076560553 10:131360469-131360491 CCGGGGCAGGGGCGGTGGGGAGG + Intergenic
1076703080 10:132284273-132284295 CAGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703089 10:132284292-132284314 GGGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703097 10:132284310-132284332 GGGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703105 10:132284328-132284350 GGGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703121 10:132284366-132284388 GGGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703134 10:132284402-132284424 CAGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703140 10:132284420-132284442 GGGGGGCAGGTGAGGTTGGGAGG + Intronic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1076996679 11:300461-300483 GCTTGGCAGAGGAGGTTGGGAGG - Intergenic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077141222 11:1025765-1025787 CTCTGGCAGGGCAGGACGGGCGG - Intronic
1077186792 11:1239068-1239090 CTGGGGCAGGGGAGGAGGTGTGG + Intronic
1077349486 11:2085838-2085860 GTGTGGCAGGGCAGGGTGTGTGG + Intergenic
1077439320 11:2560631-2560653 GTGTGGAAGGGGAGGCTGAGGGG - Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078081027 11:8204866-8204888 CTGAGGCAGGAGAGCTTTGGTGG - Intergenic
1078095303 11:8292721-8292743 CTGTGGGAGGCGAGGTGCGGTGG + Intergenic
1078256608 11:9664095-9664117 CTGTGGCTGCGGAGGTTGAGGGG + Exonic
1078740280 11:14059736-14059758 CTGTGGCAGCGGCTGCTGGGGGG - Intronic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1079033224 11:17001130-17001152 CTGGGGCTGGGGAGCTTCGGAGG - Intronic
1079328311 11:19513028-19513050 CTGGGGCAGGGGCGGTGTGGAGG + Intronic
1079356136 11:19731543-19731565 AGGTGGCAGGGGTTGTTGGGGGG + Intronic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1080846988 11:36035335-36035357 CTGTGGCGGTGGAGGTGGGCAGG - Intronic
1081608030 11:44539550-44539572 CTCTGGCAGTAGGGGTTGGGGGG + Intergenic
1081724477 11:45318455-45318477 CTGAGCCAGGGCAGGTTGAGAGG + Intergenic
1081950807 11:47040918-47040940 CTATGGCAGCGGTGGTGGGGAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082877548 11:58003344-58003366 CTGTGGCTGGAGAGATAGGGTGG - Intergenic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083773225 11:64879643-64879665 GTGTGGCCGGGGAGGATGGCGGG - Intronic
1083826727 11:65208126-65208148 TTGGGGCATGGCAGGTTGGGAGG + Intronic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084205465 11:67589178-67589200 TGGTGGCAGGGGAGGTAAGGGGG + Intergenic
1084276467 11:68053879-68053901 CTGTGGCAGGAGGCTTTGGGTGG - Exonic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084793247 11:71488385-71488407 CTGCGGGAGGCGAGGGTGGGTGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085202942 11:74712724-74712746 AGGTGGGAGGGGAGGTTGAGAGG - Intronic
1085641771 11:78197223-78197245 TTGGGGCGGGGGAGGTGGGGGGG + Intronic
1085765306 11:79276909-79276931 CTGAGGCAGCAGAAGTTGGGGGG - Intronic
1086439693 11:86815832-86815854 CAGTGGCAGGGGAGCTGGAGAGG - Intronic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088866609 11:113853629-113853651 CTGTGGGAGGCCAGGTCGGGTGG + Intronic
1089150299 11:116358759-116358781 CCAAGGCAGGGGAGGTGGGGAGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089447539 11:118565502-118565524 CTGAGGCGGGGTAGGGTGGGAGG + Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090405445 11:126473385-126473407 GCGTGGCAGGTGAGGTTGAGAGG + Exonic
1091286814 11:134412430-134412452 CGGTGCCGGGGGAGGGTGGGGGG - Intergenic
1091446811 12:548360-548382 ATTTGGCAGGGGAGGAGGGGAGG + Intronic
1091676594 12:2495425-2495447 AGGTGGCAGTGGAGGGTGGGTGG + Intronic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1092280299 12:7092930-7092952 CTGGGGCAGAGGAGGGTGTGTGG + Intronic
1092523361 12:9294789-9294811 CAGGGGCAGTGGAGGTGGGGAGG - Intergenic
1092543933 12:9437110-9437132 CAGGGGCAGTGGAGGTGGGGAGG + Intergenic
1092746552 12:11677900-11677922 CTGTGCCAGAGGACGCTGGGAGG - Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093385765 12:18551428-18551450 ATGTGGGAGGGGAGGTAGGCAGG - Intronic
1094244256 12:28269542-28269564 GGGTGGCAGGGTTGGTTGGGGGG - Intronic
1095248134 12:39946243-39946265 CTGTTCCAGTGGAGGTTGTGGGG + Intronic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096236314 12:49929628-49929650 CTTGGGCAGGGGAGTTGGGGCGG + Intergenic
1096256478 12:50065042-50065064 GTTTGGCTGGGGAGATTGGGAGG - Intronic
1096741049 12:53694551-53694573 GAGTGGGAGGGGAAGTTGGGGGG + Intergenic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1097088668 12:56488164-56488186 CTGTGGCTGGGAAGGAGGGGCGG + Exonic
1097205980 12:57321405-57321427 CTTTGGGAGGCCAGGTTGGGTGG + Intronic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1099989247 12:89707151-89707173 GTGTGGCAGGGGTGGATTGGGGG - Intronic
1100739878 12:97580390-97580412 CTGTGGGATTGAAGGTTGGGTGG + Intergenic
1101085025 12:101226933-101226955 CTGAGGCAGAGCAGGTTTGGGGG - Intergenic
1101417223 12:104518774-104518796 CTTTAGCTGGGGATGTTGGGAGG + Intronic
1101448494 12:104755458-104755480 GTGTGGCAGGGGAGTGTGTGGGG + Intronic
1101909221 12:108850003-108850025 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909258 12:108850099-108850121 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909275 12:108850139-108850161 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909324 12:108850259-108850281 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1102026134 12:109715066-109715088 CGATGGGAGTGGAGGTTGGGGGG + Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102252487 12:111397042-111397064 GTGAGGCAGGGGAGTTTAGGAGG + Intergenic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102710063 12:114918078-114918100 CAGTGGCATTGGGGGTTGGGGGG - Intergenic
1102930206 12:116856334-116856356 GCGTGGCAGGGGCGGCTGGGAGG - Exonic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1102990351 12:117311324-117311346 CCGTGGCTGGAGAGCTTGGGAGG - Intronic
1103044361 12:117723075-117723097 CAGTGGCAGGGGAGGTTATCAGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103876339 12:124130429-124130451 ATGAGGCAGGGGAGGTGCGGTGG - Intronic
1104053294 12:125210625-125210647 GGGTGGCAGGGGAGGTGGAGGGG + Intronic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105682689 13:22745283-22745305 CCGGGGCAGGGGTGGTGGGGTGG + Intergenic
1105782345 13:23715845-23715867 CTGTGGCAGGGATGGGTCGGGGG + Intergenic
1106131786 13:26946870-26946892 CTGTGGCAGGGGACATTGGCAGG - Intergenic
1106143039 13:27026969-27026991 TTGTGGCAGGTGAGGATGGGTGG - Intergenic
1106384063 13:29267315-29267337 CTTTGGAAGGCGTGGTTGGGAGG - Intronic
1107556539 13:41520731-41520753 CTGTGCCAAGGGTGGCTGGGGGG + Intergenic
1107884685 13:44865677-44865699 TCGTGGCAGGAGAGATTGGGTGG - Intergenic
1108956300 13:56162494-56162516 CAGAGGCTGAGGAGGTTGGGTGG + Intergenic
1109694955 13:65942507-65942529 CTGTGGGAGGCCAAGTTGGGAGG - Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111775801 13:92659891-92659913 CTGTGGCAAGGCAGAGTGGGAGG + Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112280175 13:98056037-98056059 CTGTGGCTGGGCAGGTGGGCAGG + Intergenic
1113279389 13:108772258-108772280 CTGAGGCAGGAGAGCCTGGGAGG + Intronic
1113923596 13:113928359-113928381 CCGTGGCCGGGCAGGTGGGGAGG + Intergenic
1114852742 14:26400614-26400636 ATGTGGCAGGGCTGGTTGGAGGG + Intergenic
1115392238 14:32866454-32866476 CTGTGGCAGGGTTGGATGGAGGG + Intergenic
1115658636 14:35468087-35468109 CTGAGGCAGTGGGGGTGGGGGGG + Intergenic
1116177976 14:41497442-41497464 GTGGGGCTGGGGAGGATGGGTGG - Intergenic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116781280 14:49240597-49240619 CTGGAGCAGGGTAGGTTGGTGGG + Intergenic
1117081507 14:52156829-52156851 CGGTGGCAGGTGGGGTTTGGGGG + Intergenic
1117716501 14:58586967-58586989 CTATGGCAGGGGAGTTTGGAGGG - Intergenic
1117750792 14:58921711-58921733 GTGTGGCAGGGGAGGGCGGCAGG - Intergenic
1117812980 14:59568132-59568154 CTGTGGCAGGGCGAGTTGAGAGG - Intronic
1117837154 14:59819430-59819452 CTGTGGCCGGGGGGGGGGGGTGG - Intronic
1118087870 14:62440263-62440285 CTGTGGCAGGGGTGTTTGCAGGG + Intergenic
1118281291 14:64431162-64431184 CTGAGGCAGGAGAACTTGGGAGG - Intronic
1118284787 14:64461588-64461610 TTTTGGCAGGGGGGGTAGGGGGG + Intronic
1118542396 14:66842473-66842495 GTGTGAAAGGGGAGGTTGTGGGG + Intronic
1119216834 14:72875806-72875828 CAGTGGCAGGGGTGTCTGGGTGG + Intronic
1119427278 14:74543953-74543975 CTGGGGCAGGGGTGGCTAGGTGG - Intronic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1121021521 14:90583093-90583115 CTGCTACTGGGGAGGTTGGGTGG - Intronic
1121535313 14:94686864-94686886 TTGTGGCAGGGGAGGTGAGGTGG - Intergenic
1121713961 14:96059681-96059703 CAGTGGCATGGGAGTTTGGATGG - Intronic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1121820025 14:96958738-96958760 CTGTGGGAGGGGACTTTGAGGGG - Intergenic
1121906820 14:97753541-97753563 CTGTGGCAGGAGGGGTGGGTTGG + Intronic
1121909109 14:97772959-97772981 CTGAGGCAGGAGAGGTGGGCAGG + Intergenic
1121956658 14:98219563-98219585 CTTTGGCAGGGGAGTTGGGAAGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122528684 14:102409016-102409038 AAGTGGCAGAGGAGGTTAGGTGG + Intronic
1122655634 14:103257614-103257636 CTGTGGGAGGCCAGGATGGGAGG + Intergenic
1122723287 14:103734334-103734356 CCGTGGCAGCGGAGGGTGGTTGG - Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1202889181 14_KI270722v1_random:139373-139395 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
1123465831 15:20514809-20514831 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1123476974 15:20597360-20597382 CAGGGGCAGGTGGGGTTGGGAGG + Intergenic
1123641037 15:22403004-22403026 CAGGGGCAGGTGGGGTTGGGAGG - Intergenic
1123652282 15:22486230-22486252 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1123742705 15:23295087-23295109 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1123760620 15:23429399-23429421 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1123862311 15:24481031-24481053 CTTTGGGAGGCCAGGTTGGGCGG - Intergenic
1123916329 15:25032287-25032309 TTTTGGCAGGGGATGTGGGGAGG - Intergenic
1123956810 15:25344980-25345002 TTTTTGTAGGGGAGGTTGGGAGG - Intronic
1124061025 15:26293839-26293861 CTGTGGCTGGGGATGTGGGTGGG + Intergenic
1124276554 15:28330783-28330805 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1124306147 15:28580824-28580846 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124484019 15:30100277-30100299 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124519561 15:30396947-30396969 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1124539092 15:30569274-30569296 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124759558 15:32438298-32438320 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1124835788 15:33194866-33194888 AGGTGGCAGGGGAGGCGGGGCGG + Intergenic
1125012922 15:34899612-34899634 CTTTGGGAGGTGAAGTTGGGAGG - Intronic
1125030237 15:35068771-35068793 CTCTGGTAGGGGTGGTTGGTTGG - Intergenic
1125477757 15:40058891-40058913 CTGGGGCTGGGGAGATTGGGAGG + Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1126668350 15:51094487-51094509 CTGGGGCTGGGGAGGACGGGAGG - Intronic
1126739393 15:51762211-51762233 CTGTGGTAGGCCAGGCTGGGAGG + Intronic
1126962045 15:54007604-54007626 CTGTTGCAGGGTGGGTTGTGGGG + Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127383513 15:58449375-58449397 CTTTGGCAGAGAATGTTGGGTGG - Intronic
1127922213 15:63503249-63503271 TTGTGGCGTGGGAGGTAGGGAGG + Intergenic
1128614131 15:69096268-69096290 CAGTCTCAGGGGAGGCTGGGAGG - Intergenic
1128957768 15:71966670-71966692 GAGTGGCAGTAGAGGTTGGGGGG - Intronic
1129161647 15:73751291-73751313 CAGAGGCAGAGGAGGCTGGGTGG - Exonic
1129162821 15:73756398-73756420 AGGTGGCCAGGGAGGTTGGGTGG - Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129518240 15:76169996-76170018 CTGTGGCTGTGCATGTTGGGTGG + Intronic
1129701158 15:77769385-77769407 CAGTCACAGGGGAGGCTGGGGGG - Intronic
1129727500 15:77909106-77909128 CCGTGGCAGGGGAGGCGGGTGGG - Intergenic
1130282788 15:82532380-82532402 CTGTGGCAGGAGAGGCGGGCAGG + Intergenic
1130758992 15:86797734-86797756 ATGGGGCAGGGGTGGTGGGGAGG + Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1132177603 15:99727889-99727911 CTGTGGCATGGAGGGGTGGGAGG - Exonic
1132189712 15:99842321-99842343 CTGTGGCAAGGCAGAGTGGGAGG - Intergenic
1132467306 16:83267-83289 CTGGGGCACGGGGGGTTGGAGGG + Intronic
1132648583 16:1010281-1010303 CTGTGGCAAGGGCGGCAGGGAGG + Intergenic
1132700712 16:1220946-1220968 CTGGGGCAGGGGTGGCTGAGGGG - Exonic
1132704201 16:1235737-1235759 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1132707317 16:1250688-1250710 CTGTGGGAGGCCAGGGTGGGAGG + Intergenic
1132762729 16:1518799-1518821 CTGTGGCAGAGCAGGGTGTGTGG + Intronic
1132801177 16:1754528-1754550 CTGTGGGAGGCCAGGGTGGGCGG + Intronic
1132803476 16:1765293-1765315 ATGTGGCAGTGGACGGTGGGAGG + Intronic
1132896142 16:2230282-2230304 CTGTGGGAGGGGCTGTTGCGAGG + Intronic
1132933783 16:2471278-2471300 CTGTGCCAGGAGGGGGTGGGGGG - Intergenic
1133241652 16:4417572-4417594 CTTTGGCAGGCCAAGTTGGGAGG - Intronic
1133514645 16:6496714-6496736 CTGTGGGAGGCCAGGGTGGGTGG + Intronic
1133640392 16:7711170-7711192 TTGCGAAAGGGGAGGTTGGGAGG + Exonic
1134013789 16:10874442-10874464 CTGTGGCAGGTGAGGGTGTGGGG - Intergenic
1134065082 16:11223191-11223213 CTGGGACAAGGGCGGTTGGGCGG + Intergenic
1134452142 16:14370169-14370191 CTGTGGCAGGGCAGTGGGGGAGG + Intergenic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1135191621 16:20359208-20359230 TTGTGGTAGGGTAGGTGGGGCGG - Exonic
1135648526 16:24185435-24185457 GTATGACAGGGGAGGGTGGGAGG - Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136395518 16:29990717-29990739 CTGGGGCAGGGGAGGATAGTGGG + Intronic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1136857935 16:33676186-33676208 CTCTGTCAGGGGGGGTGGGGGGG + Intergenic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137408482 16:48208354-48208376 CTGGGGCACTGGAGCTTGGGAGG + Intronic
1137542868 16:49377096-49377118 CTCTCGCAGGGGAGGCAGGGAGG - Intronic
1137677579 16:50311389-50311411 CAGTGGCAGGCGGGGTGGGGTGG - Intronic
1137702261 16:50505870-50505892 CAGTGTCCTGGGAGGTTGGGGGG - Intergenic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1139402664 16:66695435-66695457 CTGTGACAGAGAATGTTGGGGGG + Intronic
1139475819 16:67202081-67202103 CGGTGACAGGGTAGGGTGGGGGG + Intronic
1139965186 16:70741375-70741397 CCGGGGCAGCGGAGGTGGGGGGG + Intronic
1140027432 16:71303439-71303461 CTGTGGCTGGGGGCGGTGGGGGG - Intergenic
1140284859 16:73592594-73592616 CTGAGGCAGGGGAGAGTAGGAGG + Intergenic
1141179169 16:81740633-81740655 CTGAGGCAGGAGAACTTGGGAGG + Intronic
1141426726 16:83949200-83949222 CAGGGGCAGGGCAGGTTTGGAGG + Exonic
1141524796 16:84604307-84604329 CCGTGGGAGGGGAGCGTGGGTGG - Intronic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142073441 16:88103780-88103802 CCGTGGCATGGGGGGTTGGTGGG + Intronic
1142116304 16:88357870-88357892 CGGTGGCAGGGCCTGTTGGGAGG + Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142605449 17:1078721-1078743 ATGTGGCCGGGGAGGTTAGAGGG - Intronic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1142692960 17:1617860-1617882 CTGTGGCAGCTGAAGATGGGAGG + Intronic
1142977764 17:3655878-3655900 CTTGGGCAGGGGAGGAAGGGAGG + Intronic
1143070991 17:4293137-4293159 CTGCTGGAGGGGAGGTGGGGGGG - Intronic
1143197818 17:5089650-5089672 CTTGGGCAGGGGTGGGTGGGAGG - Intronic
1143585874 17:7849965-7849987 CTCTGGCAGGGGTGGTTCTGAGG - Intronic
1143854287 17:9837240-9837262 CTGGGACAGTGGAGGTGGGGAGG - Intronic
1143990356 17:10954454-10954476 CTCAGGCAGGGGAGGTGGGCAGG - Intergenic
1144078128 17:11737322-11737344 CGGTGGGAGGGGTGGGTGGGGGG - Intronic
1144140181 17:12340630-12340652 CTGTGGGAGGCGAAGATGGGAGG - Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144530926 17:16038679-16038701 CTTTGGGAGGGTAAGTTGGGTGG - Intronic
1144554904 17:16273605-16273627 CAGTGGCAGGGGAAATTGAGAGG + Intronic
1145367650 17:22278291-22278313 TTGTGGAAGGGCAGGGTGGGGGG + Intergenic
1145767837 17:27471562-27471584 CAGTGTCAGGGGAGGATGGTTGG + Intronic
1145883560 17:28368266-28368288 CTGTGGCTGAGGAGTTTAGGGGG - Intronic
1145907404 17:28524065-28524087 GTGGGGCAGGGGAGCCTGGGAGG - Exonic
1146040758 17:29451970-29451992 CTTTGGGAGGCAAGGTTGGGTGG + Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1147864395 17:43543210-43543232 CAGTGGGTGGGGAGGTGGGGTGG - Intronic
1147895689 17:43749961-43749983 CGGAGGCAGGGGAGATGGGGCGG - Intergenic
1148084755 17:44987435-44987457 CTCTGACAGGGGAGGTGGGATGG + Intergenic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148346653 17:46907991-46908013 CTGTGGGAGAGCAGGCTGGGGGG + Intergenic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148494519 17:48045366-48045388 CTGTGGGAGGGCAGGCTGGCTGG - Intergenic
1148699410 17:49578785-49578807 CTGTGGTTCGGGCGGTTGGGGGG - Exonic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148979577 17:51560746-51560768 CAGTGGAATGGGAGATTGGGAGG - Intergenic
1149132660 17:53323969-53323991 CTGTGGCTGGTGAGGTTATGGGG - Intergenic
1149456252 17:56791091-56791113 TTGTCCCAAGGGAGGTTGGGTGG - Intergenic
1151329840 17:73400320-73400342 GTGTGGAAGGGTTGGTTGGGAGG - Intronic
1151412040 17:73937366-73937388 ATGTGGCAGGAGTAGTTGGGTGG + Intergenic
1151484010 17:74387365-74387387 CGGTGGCTGGGGAGGTCAGGTGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151866390 17:76806121-76806143 GTGTGGCGGGGGAGGTATGGAGG + Intergenic
1152009227 17:77700675-77700697 CTGGGGCTGGGGAGGCAGGGAGG + Intergenic
1152228413 17:79103076-79103098 CAGTGGCAGGGCTGGTTGGTTGG + Intronic
1152239242 17:79152947-79152969 GTGAGGCAGGGGAGGTCTGGAGG + Intronic
1152394420 17:80023733-80023755 CTGTGGCCGGGGTGGTGGGAGGG - Intronic
1152408845 17:80111974-80111996 CTCTTCCAGGGGTGGTTGGGGGG + Intergenic
1152410511 17:80120445-80120467 GGGTGGGAGGGGAGGTGGGGAGG - Intergenic
1152461503 17:80444610-80444632 CTGCGGCAGGGGAGGGCGTGGGG + Intergenic
1152503631 17:80730768-80730790 GTTTGGGTGGGGAGGTTGGGAGG + Intronic
1152531603 17:80922378-80922400 CTCTGGCAGGGAAGGTGAGGAGG + Intronic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152784598 17:82241246-82241268 CTGTGCCGGGGGAGGTGGCGGGG + Intronic
1152944266 17:83190642-83190664 CGGTGTCAGGGGAGGCTGGTGGG - Intergenic
1153417007 18:4856919-4856941 CTTTGGCAGGCCAAGTTGGGTGG + Intergenic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1155407305 18:25503054-25503076 CTGAGGCTGGGAAGGGTGGGAGG + Intergenic
1155959545 18:31982618-31982640 TTGAGGCTGGGGAGGCTGGGAGG - Intergenic
1156202164 18:34846171-34846193 GTAGGGTAGGGGAGGTTGGGAGG - Intronic
1157270301 18:46269999-46270021 CTCTGGAAGGGGAGGTATGGAGG + Intergenic
1157395061 18:47334592-47334614 GAGTGGCAGGAGAGGTGGGGAGG + Intergenic
1157603069 18:48906517-48906539 CTGTGGGAGGCCAGGGTGGGTGG + Intergenic
1157689407 18:49668824-49668846 AAGTGGCAGGGGTGGGTGGGTGG + Intergenic
1159784549 18:72697463-72697485 CTTTGGGAGGGCAGGATGGGTGG + Intergenic
1160058155 18:75505748-75505770 CTGTAGCAGGGCAGGTGTGGAGG - Intergenic
1160774263 19:847963-847985 CTGTGGGAGGGGCGGTTCAGGGG - Exonic
1160967587 19:1753433-1753455 CGGTGGCAGGAGCGGGTGGGCGG + Exonic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161286722 19:3472199-3472221 CTGGGATGGGGGAGGTTGGGGGG - Intergenic
1161335079 19:3708644-3708666 TCGTGGTGGGGGAGGTTGGGGGG - Intronic
1161566948 19:5008030-5008052 CTTTGGAAGGGTGGGTTGGGAGG + Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161596413 19:5153196-5153218 CCGGGGTCGGGGAGGTTGGGGGG + Exonic
1161707776 19:5830078-5830100 CTGTGGCAGGGGAGCTTCGGGGG - Intergenic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162112052 19:8404639-8404661 CTGTGGCAGGGAGGGATGGAAGG + Intronic
1162188687 19:8927594-8927616 CTGTGGCTGGGCACGTAGGGAGG + Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162905313 19:13819513-13819535 CAGTGGCAGGGGGAGCTGGGGGG + Intronic
1162964105 19:14147919-14147941 CTGGGGCGTGGGAGGTGGGGAGG + Exonic
1162999324 19:14356208-14356230 GTGTGGCTGGGGAGGTGGTGGGG + Intergenic
1163064807 19:14785144-14785166 GTGTGGCTGGGGAGGTGGTGGGG - Intergenic
1163272443 19:16262374-16262396 CTGTGGCAAGGGTGCCTGGGTGG - Intergenic
1163308623 19:16498525-16498547 CTGTGGGAGGCCAGGATGGGAGG - Intronic
1163314986 19:16535575-16535597 CTGTGGCAGGGGTGGCATGGTGG + Exonic
1163441419 19:17324195-17324217 TTGGGGCAGGGGAGGTGGTGGGG + Intronic
1163454926 19:17400886-17400908 CTGTGGCAGGGGAGGTATTTGGG + Intergenic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1164734578 19:30531591-30531613 CAAGGGCAGGGGAGGTAGGGAGG - Intronic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165199137 19:34131305-34131327 CTTGGGCTGGGGAGGTTGGGAGG - Intergenic
1165312619 19:35038046-35038068 CTGGGGCAGGGCAGGCAGGGGGG + Intronic
1165333965 19:35156199-35156221 CTGTGTCAGAGGAGAATGGGTGG + Intronic
1165374358 19:35431338-35431360 GTGTGGCTGGGGGGGTGGGGTGG - Intergenic
1165428375 19:35757791-35757813 CTGTTGCAGGGGCAGTGGGGCGG - Intronic
1165430410 19:35768666-35768688 ATGGGGCAGCGGAGGATGGGGGG - Exonic
1165721645 19:38083112-38083134 GTGTGGGTGGGAAGGTTGGGTGG + Intronic
1165748013 19:38242149-38242171 TTGGGGCAGGGAAGGTTGGGAGG - Intergenic
1165789508 19:38483151-38483173 CTGAGGCAGGAGATGTGGGGAGG + Intronic
1166092021 19:40515474-40515496 GTGTGGAAGGGAAGGATGGGAGG - Intronic
1166155250 19:40906318-40906340 CTGAGGCAGGAGAGAATGGGAGG + Intergenic
1166222998 19:41377447-41377469 GTGTGGCAGGGGACTTCGGGGGG + Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166384856 19:42375336-42375358 CTGTGGCAGAGAAGGTCCGGGGG + Intronic
1166530816 19:43542433-43542455 CTGAGGGTGGGAAGGTTGGGAGG - Intergenic
1166552591 19:43676356-43676378 CTCTGGTTGGGGAGGTGGGGGGG + Intergenic
1166748099 19:45151532-45151554 CTGTGGCAGGAGAGGCTGCGGGG - Exonic
1166753124 19:45174345-45174367 CCGTGGCAGGTGGGGATGGGTGG - Intronic
1167286040 19:48599442-48599464 CTGTGGCAGGGCAGGCAGCGGGG + Intergenic
1167390321 19:49190468-49190490 CTGTGGGAGGTGAGTTTTGGGGG + Intronic
1167402081 19:49279594-49279616 CTGTGGCAGCTGCGGTTGGCTGG + Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167566593 19:50261186-50261208 ATGGGGCAGGGGATGATGGGGGG - Intronic
1167728225 19:51233720-51233742 CAGTGGCACTGGAGGTTGGTTGG + Intronic
1167765927 19:51482453-51482475 CTGTGGAAGGTGGGGTTGAGGGG + Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1168292847 19:55365489-55365511 CTGGGGCAGGGCAGGTGGAGGGG - Exonic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168588681 19:57614955-57614977 CAGTGGCAGGAGGGGTTGGGTGG + Intronic
1202664576 1_KI270708v1_random:106147-106169 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
925068708 2:950418-950440 CTTTGGCCAGGGAGGTGGGGCGG + Intergenic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
925430051 2:3783683-3783705 GTGTGGCAGTGGAGGTAGCGTGG + Intronic
925904953 2:8534841-8534863 CTGAGTCAGGGGTGCTTGGGGGG + Intergenic
925910849 2:8572831-8572853 CTGGGGCAGGAGAGGTTGTGGGG - Intergenic
927154370 2:20213144-20213166 CTGTGGAAGGGTAGGTATGGGGG - Intronic
927636883 2:24823029-24823051 CTGGGGAAGGGGAGGTGAGGTGG - Intronic
927928120 2:27026989-27027011 CTGGGGCAGGGGGCCTTGGGTGG - Exonic
928025585 2:27736197-27736219 CTGAGGGAGGGCAGGTCGGGTGG - Intergenic
928604859 2:32936270-32936292 CAGTGGCATGGGGGGTAGGGGGG - Intergenic
928628757 2:33168983-33169005 CTGTGGCAGCAGAGTTAGGGGGG + Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
929562831 2:42966422-42966444 ATGTGGCGGGGGGGGGTGGGGGG + Intergenic
929576821 2:43057325-43057347 CTGTGGCCAGGGTGGCTGGGTGG - Intergenic
929591380 2:43149308-43149330 CTGGTGCAGGGAAGGATGGGTGG + Intergenic
929892228 2:45927920-45927942 CGGAGGCAGGAGAGGGTGGGGGG + Intronic
930564452 2:53002112-53002134 GTGTGGTGGGGGCGGTTGGGAGG - Intergenic
930624838 2:53685541-53685563 CTGTAGCAGGGAAGGTTAGGAGG - Intronic
931009040 2:57886469-57886491 GCTTGGCAGGGGAGGTGGGGGGG + Intergenic
931628980 2:64282667-64282689 CTGTGGAAGGAGAGGTAGAGGGG + Intergenic
932022387 2:68100347-68100369 CAGGGGCTGGGGAGGTTTGGAGG + Intronic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932236617 2:70125481-70125503 GTGTATCAGAGGAGGTTGGGGGG - Intergenic
932800238 2:74735430-74735452 CAGTGGCGGGGGCGGTGGGGAGG - Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
934247821 2:90323410-90323432 CAGTGGCGGGGGGGGGTGGGGGG + Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
934919876 2:98334198-98334220 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
935202118 2:100866162-100866184 CTGTGGCAGAGGAGTTGAGGGGG + Intronic
935221056 2:101013193-101013215 CTGTGACGGCAGAGGTTGGGAGG - Intronic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
935878823 2:107540652-107540674 ATGGGGCTGGGGAGGTAGGGAGG - Intergenic
936486711 2:112931956-112931978 GAGTGGCAGGGGAGCTTGGCAGG + Intergenic
936787842 2:116116152-116116174 ATGAGGTAGGGGAGGTTTGGAGG + Intergenic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937991289 2:127663838-127663860 CTCTGGATGGGGAGGTTGGGAGG - Intronic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938314290 2:130315403-130315425 CTGTGGCAGGGATGATTGGAGGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938680369 2:133683766-133683788 GTGTGGCAGGGGTTGTTGTGGGG - Intergenic
938943090 2:136186551-136186573 CTGCAGCCAGGGAGGTTGGGAGG + Intergenic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
939005570 2:136782607-136782629 CTGAGGCTGGGGTGGTTGGGGGG + Intronic
939678646 2:145103683-145103705 CTAGGGCAGGGGTGTTTGGGGGG + Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940078944 2:149778203-149778225 CTGAAGCAGGTGGGGTTGGGTGG + Intergenic
942113639 2:172706818-172706840 CTTTGACAGGGCAGGTGGGGAGG + Intergenic
942127177 2:172838805-172838827 CAGTCACAGGGGAGGATGGGAGG + Intronic
942351529 2:175057989-175058011 GCCTGGCAGTGGAGGTTGGGTGG + Intergenic
942747949 2:179257035-179257057 CTGTGGCATGAGATGCTGGGTGG - Intronic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946158470 2:217821999-217822021 GTGTTCCAGGGGAGGTTGGGGGG - Intronic
946178313 2:217935345-217935367 CTCTGGCAGGAGATGATGGGAGG + Intronic
946202580 2:218079452-218079474 CTGTGGCAGGGCAGATTTGTAGG + Intronic
946253962 2:218430059-218430081 CAGAGGCAGGGAAGGCTGGGAGG + Intronic
946269646 2:218580210-218580232 CTGTGGGAGGCCATGTTGGGTGG - Intronic
946337564 2:219048842-219048864 GGGTGGCAGGGGCGGTGGGGGGG - Intergenic
946339110 2:219057083-219057105 CTGTGCCAGGTGGGGTGGGGAGG + Intronic
946631341 2:221672444-221672466 GTGGGGCGGGGGAGGGTGGGAGG - Intergenic
947700052 2:232226005-232226027 CTGCGGCTGGGAAGGTTGGGAGG + Intronic
947735333 2:232451732-232451754 CAGTGGCAGGGGTGGCTGGCAGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948776725 2:240293045-240293067 CTGTGGCTGGGGTGACTGGGTGG + Intergenic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
949066802 2:241995943-241995965 CTGTGGGAGGCCAGGGTGGGTGG - Intergenic
1168762019 20:355848-355870 CTGAGTCCAGGGAGGTTGGGAGG - Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169216606 20:3797781-3797803 CTGTGTCAGGAGAGTTTGTGGGG + Intronic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1169345290 20:4823780-4823802 CTGGGGGTGGGGAGGTGGGGGGG + Intergenic
1170040278 20:12033050-12033072 CTGAGGCATGGGAGGTTAAGTGG + Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170858800 20:20083335-20083357 CTGGGGAGGGGGAGGTTCGGAGG + Intronic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171199561 20:23230391-23230413 CACTGGCAGGGGAGGATGAGAGG - Intergenic
1171799202 20:29595090-29595112 CTTTGGGAGGGCAAGTTGGGTGG + Intergenic
1172154012 20:32810993-32811015 GGGAGGCAGGGGAGGTTGTGTGG - Intergenic
1172169575 20:32920838-32920860 CTCTGGGAGGGGAGGTAGGGAGG + Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172248691 20:33463728-33463750 CTTTGGCAGGCGAAGGTGGGAGG + Intergenic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172613409 20:36267689-36267711 CTGTGGGAGGGGAGCTGGGTGGG - Intronic
1172951119 20:38724151-38724173 CGAGGGCAGGGGAGGTGGGGGGG - Intergenic
1173464712 20:43271712-43271734 CCGTGGCATGGGATGTGGGGTGG + Intergenic
1173833871 20:46112485-46112507 CAGTGGCGGGGGAGGTGGGTGGG + Intergenic
1173910453 20:46665400-46665422 CTGGGACTGGGGAGGTTGTGGGG - Intronic
1173940166 20:46904183-46904205 CTGTTCCTGGGGTGGTTGGGAGG + Intronic
1174110133 20:48193251-48193273 TGGTGGCAGTGGAGGTGGGGAGG - Intergenic
1174274036 20:49390641-49390663 CAGCTGCAGGGGAGGCTGGGCGG - Intronic
1174388807 20:50204512-50204534 CTGTCACAGGGCAGGTTGTGTGG + Intergenic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1174965785 20:55213210-55213232 CTTTTGCAGGTGAGGTTGAGTGG - Intergenic
1175074040 20:56358936-56358958 CGGAGGCCGGGGAGGGTGGGCGG - Exonic
1175300237 20:57937870-57937892 GTGGGGCATGGGAGGTTTGGTGG + Intergenic
1175300253 20:57937920-57937942 CTGGGGCATGGGAGGTTTTGTGG + Intergenic
1175300271 20:57937970-57937992 CTGGGGCATGGGAGGTTTGGTGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175599818 20:60264207-60264229 CTGTGGCAGGGTATGTGTGGGGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176027461 20:62993374-62993396 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027507 20:62993506-62993528 TGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027514 20:62993523-62993545 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027521 20:62993540-62993562 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027529 20:62993557-62993579 GGGAGGCAGGGGAGGGTGGGAGG + Intergenic
1176027536 20:62993574-62993596 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027560 20:62993639-62993661 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027581 20:62993706-62993728 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027597 20:62993756-62993778 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176027604 20:62993773-62993795 GGGAGGCAGGGGAGGCTGGGAGG + Intergenic
1176041930 20:63070259-63070281 CTGTGGGAGGGAGGGTGGGGTGG - Intergenic
1176060488 20:63170361-63170383 CTGAGGGAGGGGAGGATGTGAGG - Intergenic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176231815 20:64036762-64036784 CTGTGGCGTGTGTGGTTGGGGGG + Intronic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1178639250 21:34332952-34332974 CTGGGGCAGGGGAGGTTTAAAGG + Intergenic
1178750418 21:35297298-35297320 GTGTGGCAGAGGGGGTGGGGTGG - Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179991094 21:44948601-44948623 CTGGAGCAGAGGATGTTGGGAGG + Intronic
1180331305 22:11483062-11483084 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
1181025386 22:20124602-20124624 CTGTGCCTGGGGAGTTGGGGTGG + Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181517487 22:23423521-23423543 CTTTGGCAGTGGAGGCAGGGAGG + Intergenic
1181549361 22:23628203-23628225 GAGTAGCAGGGGAGGTGGGGAGG - Intronic
1181600855 22:23951156-23951178 CTGTGGCAGGGCAGTGGGGGAGG + Intergenic
1181607658 22:23990170-23990192 CTGTGGCAGGGCAGTGGGGGAGG - Intergenic
1181809452 22:25394586-25394608 CTGGGCCATGGGAGGTTGGTAGG + Intronic
1182151003 22:28027156-28027178 GTGTGTCAGGGGAGGTTCTGTGG - Intronic
1182311568 22:29412399-29412421 GAGTAGCAGGGGAGGTGGGGAGG + Intronic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182585909 22:31344297-31344319 GTGTGGCAGGGGAGGAAGAGGGG + Intronic
1182923042 22:34097702-34097724 CAGTGGCCGTGGAGGTGGGGAGG + Intergenic
1183212022 22:36457121-36457143 CGGGTGCAGGGGAGGTTGGAAGG - Intergenic
1183231473 22:36584830-36584852 CTGCCGCAGGGGAGGCTGTGAGG - Intronic
1183306599 22:37086242-37086264 CTGGGGCAGGGGAGGGGTGGTGG - Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183448228 22:37874382-37874404 GTGTGGCTGGGGAGTATGGGCGG + Exonic
1183668016 22:39256308-39256330 CTGTGGCTGGGGAGGATTGTGGG - Intergenic
1184049196 22:41991767-41991789 CTGGGTCAGGCAAGGTTGGGGGG - Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184175918 22:42788623-42788645 CAGTGGCCGGGGAAGTTGGCGGG + Intergenic
1184289901 22:43493081-43493103 TTGTGACAGAGGAGGATGGGTGG - Intronic
1185069953 22:48650793-48650815 CTGGGGGAGGGGAGGCTCGGTGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
1185205291 22:49534444-49534466 CAGTGCCTGGGAAGGTTGGGTGG - Intronic
1185373540 22:50471681-50471703 GATGGGCAGGGGAGGTTGGGGGG - Intronic
949785374 3:7734235-7734257 CTTTGGCAGGGGCGGGGGGGGGG + Intronic
949895183 3:8763165-8763187 ATGTGTCCGGGGAGGCTGGGAGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950514383 3:13454648-13454670 AGGAGGAAGGGGAGGTTGGGGGG + Intergenic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
951004325 3:17599305-17599327 TTGTGTCAGTGGAGTTTGGGGGG - Intronic
951164456 3:19467964-19467986 CTGAGGCAGCAGAGGTGGGGAGG - Intronic
952396754 3:32927894-32927916 CTTGGGGTGGGGAGGTTGGGAGG - Intergenic
952419039 3:33114664-33114686 CTTTGGCAGGGCTGGATGGGAGG - Intronic
952536233 3:34312355-34312377 CTGAGGCAGGGGTGATAGGGAGG - Intergenic
952649391 3:35707174-35707196 CAGAGGCAGGGGAGGATTGGAGG - Intronic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
953456673 3:43047825-43047847 TTGAGGAAGGGCAGGTTGGGTGG - Intronic
953546236 3:43865528-43865550 TTGTTGCTGGGGAGGATGGGAGG + Intergenic
953918384 3:46935261-46935283 TGGTGGCTGTGGAGGTTGGGAGG + Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954144733 3:48628912-48628934 TGGTGGCAGGAGAGGTGGGGAGG - Intronic
954467600 3:50665570-50665592 CAGAGGCAGGGGAGGCTGAGTGG - Intergenic
954656229 3:52195914-52195936 CTGTGGGGGTGGCGGTTGGGGGG - Intergenic
954847347 3:53571398-53571420 TTGTGGCAGGGGCAGTAGGGTGG + Intronic
955250782 3:57279900-57279922 TTCTGGCAGCGGGGGTTGGGGGG + Intronic
955280956 3:57594329-57594351 CTTTGGGAGGCCAGGTTGGGAGG - Intronic
955963358 3:64363486-64363508 CAGTGACTGGGGAGGTGGGGTGG - Intronic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
957373744 3:79330159-79330181 ATGTGGCAGTGGAGGCGGGGAGG + Intronic
957921243 3:86751163-86751185 CTAAGGTAGGGGAGGTTAGGAGG - Intergenic
958775992 3:98483430-98483452 CTGTGGCAGGTAAGGAGGGGTGG - Intergenic
959253040 3:103972523-103972545 CTGGGGCAGGGGTGGAGGGGCGG + Intergenic
959261116 3:104081664-104081686 CTGTGGTGGGGGGGGTGGGGGGG + Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960926687 3:122801345-122801367 CTTTGGGAGGCCAGGTTGGGTGG + Intronic
961480060 3:127173830-127173852 CAGAGACAGGGAAGGTTGGGAGG - Intergenic
961545823 3:127632267-127632289 CTGTGGCATGGCAGGCGGGGAGG - Intronic
961972543 3:130985635-130985657 GTGGGGCGGGGGAGGTGGGGTGG - Intronic
961988058 3:131158406-131158428 CAATGGCAGGGGAGGTGAGGTGG - Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962818152 3:139020751-139020773 CGGTGGTAGGGGAGGCTGGTTGG + Exonic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963312093 3:143720701-143720723 AGGTGGCTGGGGAGGTTAGGAGG - Intronic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
963703323 3:148654426-148654448 CTTTGACAGGGGAGGGTGGTAGG - Intergenic
963759458 3:149272459-149272481 CTTTGGGAGGCCAGGTTGGGAGG - Intergenic
963891877 3:150644877-150644899 CTGTGGCAGGCCAAGGTGGGTGG + Intergenic
963967864 3:151393499-151393521 CGGTGGGAGGGGGGGTTGTGGGG - Intronic
964952420 3:162312825-162312847 CAGTTGCTGGGGAGGTTGAGAGG - Intergenic
965297572 3:166969307-166969329 CTTTCGCTGGGGATGTTGGGCGG + Intergenic
965530907 3:169769234-169769256 GTGGGGCTGGGGAGGTTGGGGGG - Intronic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
966657313 3:182374140-182374162 CAGTGGAAGTGGAGGTTGGGAGG + Intergenic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
967912937 3:194556910-194556932 CTATGACAGGGCAGGATGGGAGG - Intergenic
968815887 4:2821456-2821478 CTGGGGCAGTGGAGCTAGGGTGG + Intronic
968875600 4:3266036-3266058 CTGTCGGAGGCGAGGCTGGGAGG + Intronic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969125339 4:4943805-4943827 CTGAGGCAGGGGTTGTGGGGTGG + Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969310284 4:6349002-6349024 CTGGGGCCGGGGAGGTTGTGAGG - Intronic
969441987 4:7222711-7222733 CTGTGGCAGGAGAGAGCGGGAGG + Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969724346 4:8910506-8910528 CAGTGGCAGGGGTGGGGGGGCGG + Intergenic
970562347 4:17294974-17294996 CGGGGGCAGGGAAGGTTGGGAGG - Intergenic
971038652 4:22725064-22725086 CTGGGGCAGGGGATATGGGGGGG - Intergenic
972243481 4:37219496-37219518 CTCTGGCAGCGGAGGAAGGGAGG + Intergenic
972323110 4:37991052-37991074 CTGGGGCGGGGGTGGGTGGGGGG + Intronic
972711217 4:41597019-41597041 TTGTTGCAGGTGGGGTTGGGGGG - Intronic
973256331 4:48117129-48117151 CTTTGGGAGGCCAGGTTGGGCGG - Intronic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
978289547 4:107120788-107120810 CTGGGGGTGGGGAGGTGGGGTGG + Intronic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
978904814 4:113993647-113993669 CTGGGGCAGGGATGGTGGGGTGG - Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980070703 4:128240651-128240673 CTGTGGCAGGGAAGATCAGGTGG + Intergenic
980590768 4:134885135-134885157 TTTTGGCAGGGTAGGGTGGGGGG - Intergenic
981057104 4:140374055-140374077 CTGCGGGAGGGGCGTTTGGGTGG + Intronic
981689341 4:147489668-147489690 CTGTGGCATGGAAGGTGGGATGG + Intronic
982062784 4:151621543-151621565 GTGTGGCAGGGGGTGGTGGGGGG + Intronic
984146730 4:176070762-176070784 CTTTGGCAGGCCAAGTTGGGTGG - Intronic
985649752 5:1101955-1101977 CTGTGGCTGGGGGGCTTGGCAGG - Intronic
985673155 5:1216737-1216759 CTGGGGCCAGGGAGGCTGGGAGG - Intronic
985877952 5:2614518-2614540 GTATGGCAGGTGAGGCTGGGAGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985994847 5:3592244-3592266 CTGTGGGGGTGGGGGTTGGGCGG - Intergenic
987258273 5:16179486-16179508 CGGCGGCGGGGGAGGTTGCGGGG + Exonic
987294520 5:16538153-16538175 CTGTGGCAGGTGGGGTCCGGTGG - Intronic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988614917 5:32765973-32765995 CTGTGGCAGTAGGGGTTGCGGGG + Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
989035669 5:37169205-37169227 CTGTGGCAGAGCAGGTTGGAAGG + Exonic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989210627 5:38855690-38855712 CGGTGGCAGTGGGGGTTGGGGGG - Intronic
989213981 5:38884820-38884842 CTTTGGCAAGGGAGGCAGGGAGG - Intronic
990605382 5:57404071-57404093 ATGGGGCAGGGGAGGTGGGGAGG + Intergenic
991536856 5:67678750-67678772 CTGGGGCTGGGAAGGTTGGGGGG + Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
991965475 5:72086203-72086225 CTGGGGAAGGGTGGGTTGGGGGG + Intergenic
992484458 5:77181190-77181212 CTGTGGGAAGGGATGTTTGGAGG + Intergenic
992785150 5:80163096-80163118 CTTTGGGAGGGCAGGGTGGGTGG - Intronic
994031961 5:95153233-95153255 TGGTGGCAGGAGAGGTCGGGGGG - Intronic
994252710 5:97555774-97555796 CTGTGGCAGGGTGGGGCGGGGGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995867047 5:116702364-116702386 CTTTGGGAGGCCAGGTTGGGCGG - Intergenic
995878789 5:116820994-116821016 CTGGGGAAGGGTAGGTAGGGTGG - Intergenic
996590966 5:125147427-125147449 CTGTGGCCGGGGAGGAAGGGAGG - Intergenic
998170272 5:139868644-139868666 CTGAGGCCCGGGAGGTGGGGTGG - Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998188487 5:140001616-140001638 CTTTGGCAGGGCAAGGTGGGAGG + Intronic
998449202 5:142221177-142221199 CTGGGGCTGGGGTGGTAGGGTGG + Intergenic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999269597 5:150289036-150289058 CTGAGAAAGGGGAGGTAGGGAGG + Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
1000105371 5:158054102-158054124 ATGAGGCAAGGGGGGTTGGGTGG - Intergenic
1000460430 5:161510249-161510271 TAGAGGCTGGGGAGGTTGGGGGG - Intronic
1001205607 5:169759891-169759913 CTGTGGCAGGGGATGTTTTCAGG + Intronic
1002322749 5:178385236-178385258 CTCTGGCAGGGTGGGTTGCGGGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1004249808 6:14014622-14014644 GTGGGGCATGTGAGGTTGGGAGG - Intergenic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1004723471 6:18289388-18289410 TTGTGGCAGAGGGGATTGGGAGG + Intergenic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006783006 6:36644823-36644845 CTGTGGGAGGCCAAGTTGGGAGG + Intergenic
1006792639 6:36714050-36714072 CTGTGGCAGCCGGGGATGGGGGG - Intronic
1006830637 6:36965894-36965916 TTGGGGCTGGGGAGGTTGGAGGG - Intergenic
1006912407 6:37571962-37571984 CTCTGGCAGCTGAGGCTGGGAGG - Intergenic
1007099087 6:39232146-39232168 CTGGGGCAGGGGAGTTGGAGAGG - Intergenic
1007179156 6:39915838-39915860 CTGGGGCTGGGGTGGTGGGGAGG + Intronic
1007181391 6:39931799-39931821 CTGTGGCGGGGGAAGCAGGGAGG - Intronic
1007209327 6:40179479-40179501 CTATGATAGTGGAGGTTGGGAGG + Intergenic
1007746155 6:44044078-44044100 CTGGGGGAGGGGGGGTTGTGGGG - Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008700723 6:54096424-54096446 CTGTGGAAGGTGTGGTTGGCAGG + Intronic
1009847306 6:69150374-69150396 CTGTGGCAGTGGTGTTTGTGGGG - Intronic
1010026268 6:71221367-71221389 CTGTCTCAGGGGTGGTGGGGGGG - Intergenic
1011430049 6:87275780-87275802 ATGGGGCAGGGGTGGTTGTGAGG - Intergenic
1011651507 6:89510691-89510713 CTAGGGCCGGGGAGATTGGGGGG - Intronic
1012034274 6:94111550-94111572 ATGTGGGAGGTGAGGTTTGGTGG + Intergenic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1015059793 6:128949318-128949340 CTGGGGCAGGGTGGGGTGGGTGG - Intronic
1016395394 6:143618590-143618612 GACTGGCAGGGGAGGCTGGGGGG + Intronic
1016915912 6:149244342-149244364 CGGTGGCGGTGGAGGGTGGGTGG + Intronic
1017618441 6:156270099-156270121 CTGTGGCAGAGGTGGCTTGGGGG - Intergenic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1017884331 6:158586702-158586724 CTTTGGGAGGGTAGGGTGGGAGG + Intronic
1018074595 6:160200671-160200693 CTGTGGGAAGAGAGGTGGGGAGG - Intronic
1018302647 6:162419644-162419666 CTATGGGAGGTGAGGTTAGGGGG + Intronic
1018312482 6:162525359-162525381 CAGGCTCAGGGGAGGTTGGGTGG - Intronic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1018767275 6:166944478-166944500 GTGGGGCAGGAGAGGTGGGGTGG - Intronic
1019055749 6:169222183-169222205 CCGGGGCAGGTGAGGTTGGCTGG - Exonic
1019155787 6:170038059-170038081 CTGTCACAGGGGAGGGTGTGGGG + Intergenic
1019434899 7:1017537-1017559 GGATGGCAGGGGAGGTGGGGAGG + Intronic
1019479794 7:1261247-1261269 CAGGGGCAGGGGAGGATGGCAGG + Intergenic
1019498339 7:1351956-1351978 CAGTGGCCGGGCAGCTTGGGTGG - Intergenic
1019677220 7:2321209-2321231 CTGTGGCAGGAAACGGTGGGGGG + Intronic
1020250377 7:6463485-6463507 CTTTGGCAGGCCAGGGTGGGAGG + Intronic
1020317303 7:6914947-6914969 CTGGGGAAGGGGGGGTGGGGAGG + Intergenic
1021433260 7:20585227-20585249 TTGTGGCAGTGGAGCTGGGGAGG - Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022090554 7:27105291-27105313 CTGAGGGAGGGGTGGTTTGGAGG - Intergenic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023370825 7:39510523-39510545 CTGTTGTGGGGGAGGTGGGGGGG + Intergenic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1025982553 7:66418716-66418738 CAGTGTCAGTAGAGGTTGGGTGG - Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1026978659 7:74514088-74514110 CTGTGAAAGGGGAGGACGGGTGG + Intronic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027254974 7:76425352-76425374 CGGTGGGAGGTGGGGTTGGGTGG + Intronic
1028449673 7:90967120-90967142 AGGTGGGAGGGGAGGTAGGGAGG + Intronic
1028669412 7:93384062-93384084 CTGGGGCAGGGCTGATTGGGAGG - Intergenic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029548593 7:101224278-101224300 CGGTGGCAGGGGTGAGTGGGAGG - Intergenic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029859947 7:103559770-103559792 ATGTGGGAGTGGAGGTTGAGAGG + Intronic
1030065148 7:105653739-105653761 CTGGGGCAGGAGGGGTGGGGTGG - Intronic
1030123429 7:106133038-106133060 GTGTGGGGGGGGGGGTTGGGGGG + Intergenic
1030151397 7:106409178-106409200 CTTTGGGAGGGCAGGATGGGAGG + Intergenic
1031367819 7:120924914-120924936 CAGGGGCAGGGGAGGTTTGAGGG - Intergenic
1032019756 7:128400737-128400759 GGCTGGCAGGGGAGGCTGGGAGG + Intronic
1032075614 7:128834468-128834490 GTGGGGCAGGGGTGGGTGGGTGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032175954 7:129626061-129626083 CTGTGGCAGGCCAAGGTGGGAGG - Intronic
1032263931 7:130357272-130357294 CTGTGGCAGGTGGGGCGGGGAGG + Intronic
1032359748 7:131244425-131244447 CTGTGAGAGGGGAGGTGGTGGGG - Intronic
1032435848 7:131899754-131899776 CTGTGGCCTGGGAGATTGGCAGG + Intergenic
1032852128 7:135804166-135804188 CTGAGGTGGGGGAGGTAGGGAGG - Intergenic
1033143313 7:138847380-138847402 GTGTGGTAGGGGAGGAAGGGCGG + Intronic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1034176531 7:149104405-149104427 GTGTGGCAGGCGAGCTTGGAAGG + Exonic
1034314311 7:150115958-150115980 CTGTGGCAAGGAAGTTTGAGTGG - Intergenic
1034340018 7:150346863-150346885 GTGGGGAAGGGGATGTTGGGAGG + Intergenic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036662073 8:10715179-10715201 CTGTGTCAGTGGGGCTTGGGAGG + Intergenic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036813519 8:11884609-11884631 CTGTGTCAGGGAGGGTGGGGAGG + Intergenic
1037150017 8:15626025-15626047 CTGTGGCGAGGGAGGCTGGGTGG + Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037763469 8:21757209-21757231 CTGCGGCAGGGCAGTTGGGGAGG - Intronic
1037820434 8:22132384-22132406 CTGTGGCAAGGCAGGCTGGTAGG + Intronic
1037951332 8:23020088-23020110 CAGGAGGAGGGGAGGTTGGGGGG + Intronic
1038013613 8:23494546-23494568 CTGAGGCATGGCAGGTTGGCAGG - Intergenic
1038085179 8:24188301-24188323 CTGTGGCAGGTCAACTTGGGTGG + Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039768509 8:40658476-40658498 ATGGGGCATGGGGGGTTGGGAGG + Intronic
1039771992 8:40696801-40696823 CCTTGGCAGGGGAGAGTGGGAGG - Intronic
1040314629 8:46254478-46254500 GTGTGGCAGGGTAGCGTGGGCGG + Intergenic
1040656796 8:49519772-49519794 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1040764298 8:50888494-50888516 CTGTTGCAGGGTAGGGTGGTGGG - Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042820289 8:72923008-72923030 CTCAGGCAGTGGGGGTTGGGGGG + Intronic
1043594807 8:81872820-81872842 CTGGGGCAGGGTGGGTGGGGAGG - Intergenic
1045227181 8:100260511-100260533 CTTTGGGAGGCCAGGTTGGGAGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045482063 8:102600709-102600731 CTGTGGCAGGGACGGCAGGGCGG - Intergenic
1045844579 8:106618353-106618375 GTTTGGCTGGGGAGGTTAGGAGG + Intronic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1047183812 8:122614172-122614194 CTGTGGTTGGGGTGGTGGGGGGG + Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1048224606 8:132572968-132572990 TTGTGGGAGGAGAGGTTGGTGGG - Intronic
1048516826 8:135118973-135118995 CTGTAGCAGGGAAGGAAGGGTGG - Intergenic
1049003917 8:139842987-139843009 CTGGGGCAGGCCAGGTTGGCTGG - Intronic
1049162555 8:141106460-141106482 CCACGGCAGGGGAGGTTGGGTGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1049765076 8:144351451-144351473 CTCTGGCTGGGGAGCTTTGGGGG - Intergenic
1049957884 9:710372-710394 CTTTGGGAGGCCAGGTTGGGTGG + Intronic
1049998685 9:1053254-1053276 CTGTGGCAGGGCAGGCAGGGTGG - Intronic
1050457253 9:5846039-5846061 CTGGGTCTGGAGAGGTTGGGTGG + Intergenic
1050624044 9:7484868-7484890 CTGTTGGAGGGTAGGGTGGGAGG + Intergenic
1051010148 9:12402248-12402270 TTGTTGGAGGGGAGGTTAGGAGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052311624 9:27074804-27074826 CTGTGGCAGGGGATGGCTGGAGG + Intergenic
1054717048 9:68567060-68567082 TTATGGGAGGTGAGGTTGGGTGG - Intergenic
1055201083 9:73663251-73663273 CTTTGGCAGGCCAAGTTGGGAGG + Intergenic
1056488100 9:87079084-87079106 CTGTCGGAGGGCAGGGTGGGTGG + Intergenic
1056517914 9:87372431-87372453 CTGTGGGAGGTGGGGTTGGAAGG - Intergenic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1057197511 9:93123129-93123151 GTGTGGTAGGGGAGCTTGAGAGG + Intronic
1057211441 9:93203022-93203044 GGGTGGCAGTGGAGGATGGGGGG + Intronic
1057569101 9:96190264-96190286 CCTTGGCAGGGGTGGTTGGAAGG + Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058100546 9:100914292-100914314 CTGTGGCAGCTGTGGTTGGCTGG + Intergenic
1058526811 9:105867322-105867344 CTGTGGCCGGGGTGGGTGTGGGG + Intergenic
1058687209 9:107489496-107489518 CTGTGGCCGGGGCGGTGGGCGGG + Exonic
1059331100 9:113536378-113536400 GTGAGCCAGGGGAGGTGGGGAGG + Intronic
1060047715 9:120353849-120353871 CAGTGGCTGGGAAGGGTGGGAGG + Intergenic
1060087153 9:120713782-120713804 CGGTGGCAGGTGGGGTGGGGAGG + Exonic
1060116754 9:120947647-120947669 CTTTGACAGGGCAGGTTGGGTGG - Intergenic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1060727830 9:126017485-126017507 CAGTGGCAGTGGAGGTGGAGAGG + Intergenic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061127535 9:128686316-128686338 AGGTGGCAGGGAGGGTTGGGAGG + Intronic
1061240190 9:129365672-129365694 CTGTGGCAGGCCAGGTGCGGTGG + Intergenic
1061832032 9:133302309-133302331 CTGAGCCTGGAGAGGTTGGGAGG - Intergenic
1061884562 9:133585079-133585101 CTGTGGCAAGGGGGCCTGGGCGG + Intronic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062461387 9:136663947-136663969 CTCAGGCAGGAGAGGTGGGGAGG + Intronic
1062552809 9:137097893-137097915 CGGTGGCAGGGGAGGCTTGGTGG - Exonic
1062574757 9:137200858-137200880 CTATGGCAGGGGAGGAGGGCGGG + Intronic
1062619151 9:137411690-137411712 CGGGGGTGGGGGAGGTTGGGGGG + Intronic
1062631051 9:137463340-137463362 CTGTGGCAGGGGCCGTGGGGCGG + Intronic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1185999191 X:4989229-4989251 CGGAGGGAGGGGAGGTAGGGAGG - Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187833959 X:23411882-23411904 GGGTGGCGGGGGAGGTGGGGTGG + Intergenic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1189232910 X:39466090-39466112 TGGTGGCAGGGGTGGTTGGGGGG - Intergenic
1189303192 X:39967657-39967679 CCATGACACGGGAGGTTGGGTGG - Intergenic
1189537969 X:41956085-41956107 CTGTGGATGGGGAGCTTGAGTGG - Intergenic
1189608914 X:42710625-42710647 GTGTGGCAGTGGAGGTATGGGGG + Intergenic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1190452271 X:50593968-50593990 AGGTGGCAGGAGGGGTTGGGGGG + Exonic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1191758785 X:64624591-64624613 CACAGGAAGGGGAGGTTGGGAGG - Intergenic
1192997850 X:76531453-76531475 CTGTGGCAGGGCAGACTTGGTGG + Intergenic
1193067574 X:77275739-77275761 CTGTGGCAGTGGTGGTGGTGGGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194583414 X:95704630-95704652 CTTTGTGAGGGGGGGTTGGGAGG - Intergenic
1195138362 X:101932909-101932931 CTTTGAGAGGAGAGGTTGGGGGG - Intergenic
1195949911 X:110259163-110259185 GTGTGTCAGGGGAGTTTGAGGGG - Intronic
1195966365 X:110433430-110433452 CTGGGGTAGGAGAGGATGGGAGG + Intronic
1195967229 X:110439660-110439682 CTGTGGTGGGGGCGGTGGGGTGG + Intronic
1196515658 X:116606968-116606990 CTGTGGGAGGTGAGATTAGGGGG + Intergenic
1197273276 X:124449170-124449192 TGGAGGCAGGGGAGGTTGTGTGG - Intronic
1197617110 X:128705517-128705539 CTGAGGCTGGGGAGGGTTGGGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197790451 X:130248955-130248977 GTATGGCAGAGGAGGGTGGGCGG - Intronic
1197805013 X:130390300-130390322 CTGTTGAAGGGGGGTTTGGGGGG - Intergenic
1197806383 X:130402227-130402249 CGGTGGCGGGGGGGGTGGGGAGG - Intronic
1198805970 X:140495132-140495154 CTATGGCTGGAGGGGTTGGGAGG - Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200067136 X:153509332-153509354 CTGTCCCGGAGGAGGTTGGGAGG + Exonic
1200116701 X:153772690-153772712 ATGCGGCAGGGGTGGGTGGGAGG + Intronic
1202627119 Y:56871089-56871111 CCGTGGAAGGGGAGGAGGGGTGG - Intergenic