ID: 1057642220

View in Genome Browser
Species Human (GRCh38)
Location 9:96835571-96835593
Sequence CTGTTTCAGCTGAAGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057642220_1057642224 -7 Left 1057642220 9:96835571-96835593 CCTAGCTGCTTCAGCTGAAACAG 0: 1
1: 0
2: 5
3: 28
4: 342
Right 1057642224 9:96835587-96835609 GAAACAGCCATGGGGTCAAGTGG No data
1057642220_1057642226 4 Left 1057642220 9:96835571-96835593 CCTAGCTGCTTCAGCTGAAACAG 0: 1
1: 0
2: 5
3: 28
4: 342
Right 1057642226 9:96835598-96835620 GGGGTCAAGTGGCTCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057642220 Original CRISPR CTGTTTCAGCTGAAGCAGCT AGG (reversed) Intronic
900481836 1:2903120-2903142 CGGTGTCGGCTGAAGGAGCTGGG - Intergenic
900701092 1:4049096-4049118 GGGTATCAGCTGAAGCAGCTCGG + Intergenic
900871330 1:5305755-5305777 ATGTCTCAGCTCAAGCAGCCAGG + Intergenic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
905369710 1:37476565-37476587 CTGACTCAGCTGAAGCAGCCTGG + Intronic
907004067 1:50892665-50892687 GTCTTTCAGTTGAATCAGCTTGG + Intronic
907358716 1:53897533-53897555 CAGTCTCAGCTGCAGCAGCAGGG - Intronic
908913092 1:69095671-69095693 TTGTTTCAACTGAAGCTACTTGG + Intergenic
909083681 1:71146805-71146827 CAGCTGTAGCTGAAGCAGCTAGG - Intergenic
910483338 1:87682750-87682772 CTGTGCCAGCTGAAGCTTCTGGG - Intergenic
910791641 1:91056845-91056867 CTGATTATCCTGAAGCAGCTGGG - Intergenic
911644057 1:100320163-100320185 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
911780328 1:101868810-101868832 TGGTTGGAGCTGAAGCAGCTGGG - Intronic
912172991 1:107123393-107123415 ATGTTACAGCTGAAGGAGCCAGG - Intergenic
912502709 1:110132835-110132857 CATTTTCAGCTGAGGCAGTTGGG + Intergenic
913595866 1:120376054-120376076 ATGTGTCAGCTCAAGCAGTTAGG + Intergenic
914091412 1:144502922-144502944 ATGTGTCAGCTCAAGCAGTTAGG - Intergenic
914307191 1:146431267-146431289 ATGTGTCAGCTCAAGCAGTTAGG + Intergenic
914594915 1:149141854-149141876 ATGTGTCAGCTCAAGCAGTTAGG - Intergenic
915100095 1:153492990-153493012 CTTTTTCCACTGATGCAGCTTGG + Intergenic
916987507 1:170207502-170207524 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
917228903 1:172814556-172814578 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
919044193 1:192430652-192430674 CAGTTATAGCTGGAGCAGCTGGG - Intergenic
919067211 1:192707709-192707731 CTGTCTCAGTTCAAGCAGCCAGG - Intergenic
919371947 1:196739084-196739106 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
922164076 1:223100514-223100536 CAGCCACAGCTGAAGCAGCTGGG - Intergenic
923483609 1:234407738-234407760 CTGTTTCAGCTTCAGCCACTGGG + Intronic
924883368 1:248187547-248187569 CTGTTTCTGCTGAGTCATCTTGG - Intergenic
1062884268 10:1004616-1004638 CTGCTTCAGCTCAGGCAGCAGGG + Intronic
1063864599 10:10350531-10350553 ATGTTTCAGCTCAAGCAGTTAGG + Intergenic
1068314503 10:55323016-55323038 TGGCTTGAGCTGAAGCAGCTGGG - Intronic
1068920527 10:62478522-62478544 CTGCTTCAGCTCAAGCAGGAAGG + Intronic
1070581591 10:77724617-77724639 CAGTTGGAGCTGGAGCAGCTGGG - Intergenic
1071454770 10:85837411-85837433 CTGTTGCAGCTGTCGCACCTTGG + Intronic
1072601208 10:96931755-96931777 TTGTTTCAGCAGCAGCAGTTAGG + Intronic
1073810990 10:107152066-107152088 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075409458 10:122216635-122216657 GTGTTTCTGGTGTAGCAGCTGGG - Exonic
1075520373 10:123140103-123140125 CTGTTGCAGCTGCAGCAGCTAGG - Intergenic
1075733251 10:124648726-124648748 CTGTTTCATCTGTAGGACCTTGG - Intronic
1077214256 11:1388863-1388885 CTCTTTCAGGTTGAGCAGCTGGG - Intergenic
1077261046 11:1621088-1621110 CTTTTCCAGCTGGAGCAGCTGGG - Exonic
1077923361 11:6657001-6657023 CAGTTTCAGCTGAAGAAGAAGGG + Intergenic
1078485560 11:11720029-11720051 CTGCTGGAGCTGAACCAGCTAGG + Intergenic
1079484180 11:20916875-20916897 CTTTTCCAGATGAAGCAACTGGG + Intronic
1079827836 11:25220691-25220713 CTGTTTCAGTTGAAAGATCTTGG + Intergenic
1080096691 11:28416728-28416750 TTGTTTCTCCTGAGGCAGCTGGG - Intergenic
1081713415 11:45232528-45232550 CTGTTTCAGCTGTTTCAGCCTGG - Intronic
1082072965 11:47953906-47953928 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
1082612402 11:55317110-55317132 CAGTTTTAGCTGAAGCAGTGTGG + Intergenic
1083937958 11:65880212-65880234 CTCTTTCAGCTCTAGCGGCTGGG - Exonic
1084420817 11:69059641-69059663 CTGCTTCAGGTGAAAGAGCTGGG - Intronic
1084798899 11:71528093-71528115 CTTTTCCAGCTGGAGCAGCTGGG + Exonic
1085196775 11:74677337-74677359 CTGTTTCATCTGGAGCATATGGG + Intergenic
1086103101 11:83122029-83122051 ATGTTTCAATGGAAGCAGCTGGG - Intergenic
1086155905 11:83665849-83665871 CTCTATCAGCTGTAGCAGTTAGG + Intronic
1086541176 11:87914806-87914828 CTGCTTCAGCCAGAGCAGCTAGG - Intergenic
1091595225 12:1873954-1873976 CTCTTTCAGCTGAGGCAGATGGG + Intronic
1092397817 12:8143932-8143954 CTGCTTCAGCTCAAGCCCCTAGG - Intronic
1092670228 12:10853841-10853863 CTGAGTCTGCTGATGCAGCTGGG + Intronic
1093038121 12:14352172-14352194 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1094397634 12:30025105-30025127 CTGCTGGAGATGAAGCAGCTGGG + Intergenic
1095814884 12:46410436-46410458 ATTTTTCAGATGAAGAAGCTTGG + Intergenic
1096111316 12:49030893-49030915 CTGTTTCAGCTGTTTCAGCAAGG + Exonic
1097554040 12:61115413-61115435 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1097921642 12:65081496-65081518 CTGCTTCACATGATGCAGCTAGG + Intronic
1098127515 12:67315336-67315358 CTGCCTCAGCTGTAGCAGCTAGG - Exonic
1098655669 12:73026755-73026777 CTGTTTAAGCAGAAGCATTTAGG + Intergenic
1098713658 12:73801273-73801295 CAGCTAGAGCTGAAGCAGCTGGG - Intergenic
1099390181 12:82070046-82070068 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1100137130 12:91567126-91567148 CTACTTCATCTGAACCAGCTGGG - Intergenic
1100469222 12:94874661-94874683 CTCATTCAGGTGAAGGAGCTCGG + Intergenic
1100786966 12:98088956-98088978 ATGTTTCAGCTTGAGCAACTGGG - Intergenic
1100883358 12:99042367-99042389 TGGTCTCAGCTGAAACAGCTGGG - Intronic
1103418249 12:120759301-120759323 CCATTTCAGATGAAGCAGCTCGG + Intergenic
1104500895 12:129284303-129284325 CTGTTTCAGATGATGTAGATGGG - Intronic
1106864413 13:33948202-33948224 CAGCTAGAGCTGAAGCAGCTGGG - Intronic
1107596573 13:41969223-41969245 CTGCCCCAGCTGAAGCAGCCAGG + Intergenic
1107882875 13:44848513-44848535 CTGCTTCAGATTGAGCAGCTGGG + Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108670737 13:52685416-52685438 CTGTTTCATATGTAGCATCTAGG + Intronic
1109281568 13:60362766-60362788 CTTTTACAGCTGAAGCAATTTGG + Intergenic
1109667162 13:65553904-65553926 CTGTTGCCCCTGAAGCAGTTGGG + Intergenic
1109922409 13:69083339-69083361 GTGTTTCAGCTGAAACACTTGGG + Intergenic
1110166364 13:72448085-72448107 CAGCTGAAGCTGAAGCAGCTGGG - Intergenic
1111049365 13:82859530-82859552 CTGTTTCTCCTGAACCAACTAGG + Intergenic
1111780064 13:92711906-92711928 CTCTTTCAACTAAAGCAGTTTGG - Intronic
1113424468 13:110196537-110196559 CTGGTTGAGCTGAAGCAGGCAGG - Intronic
1113559642 13:111268009-111268031 CTGTTACAGCTGATGTAACTCGG - Intronic
1115024011 14:28718605-28718627 ATATTTCAGCTGAAGCAGTCAGG + Intergenic
1115779279 14:36751336-36751358 CTGTTTGAGCTGAAGAATGTAGG + Intronic
1116098927 14:40408545-40408567 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1116264763 14:42674169-42674191 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
1117483388 14:56170945-56170967 CTGTTTCAGCTGCTGCAACAGGG - Intronic
1117960095 14:61154074-61154096 CTCTTTGGGCTGCAGCAGCTGGG + Intergenic
1118247516 14:64125709-64125731 CTGTTTTAGCATAAGCTGCTGGG - Intronic
1119993702 14:79228496-79228518 CTATTTCTGGTGAAGCAGTTTGG - Intronic
1121318771 14:92978622-92978644 CTGCTGGAGCTGGAGCAGCTGGG - Intronic
1121472340 14:94165377-94165399 CTGTTGCTAATGAAGCAGCTCGG + Intronic
1121712064 14:96045878-96045900 CTGTTCCAGCTGATGCCACTCGG - Intronic
1121715215 14:96068969-96068991 ATGTCTCAGCTGAAGCAGGCAGG - Intronic
1125968844 15:43895651-43895673 CTGTTGCATTTGAAGCAGTTTGG - Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1126942110 15:53778742-53778764 TTGCTGGAGCTGAAGCAGCTGGG + Intergenic
1128719309 15:69934681-69934703 CTGGCACAGCTGAAGCATCTAGG + Intergenic
1129628901 15:77235838-77235860 ATGCTGGAGCTGAAGCAGCTGGG - Intronic
1131095506 15:89652244-89652266 CTGTTCTAGCTGGAGCAGTTGGG - Intronic
1131723800 15:95201374-95201396 CTGCTGGAGCTAAAGCAGCTGGG - Intergenic
1132067652 15:98745387-98745409 CTGTTACAGGTGAGGAAGCTGGG + Intronic
1132303826 15:100794092-100794114 CGGCTGGAGCTGAAGCAGCTGGG + Intergenic
1133863935 16:9624009-9624031 CTGTATCAGCTGAAGCCAGTGGG - Intergenic
1134035412 16:11026757-11026779 CAGTTTCATCACAAGCAGCTTGG - Intronic
1134857157 16:17529837-17529859 CTGTTTTAGATCAAGCAGCTGGG + Intergenic
1135112238 16:19699319-19699341 CACTTACAGATGAAGCAGCTGGG + Intronic
1138997618 16:62474129-62474151 CAGTTGGAGCTGAAGCAGCTGGG - Intergenic
1140809021 16:78559141-78559163 CTGTAACTGCTGAAGCACCTGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142109581 16:88324047-88324069 AGGCTTCAGCTGGAGCAGCTGGG + Intergenic
1142887685 17:2922989-2923011 CTGCCTCAGCTGGAGTAGCTGGG + Intronic
1143267113 17:5646895-5646917 CTTGTTCAACTGAAGAAGCTAGG - Intergenic
1144060531 17:11580158-11580180 ATGTTCCAGCTGAAGCCGTTAGG + Intergenic
1145218591 17:21070411-21070433 CAGTTACACCTGAAGCAGATAGG - Intergenic
1145841749 17:28000876-28000898 ATTTTGCAGGTGAAGCAGCTGGG + Intergenic
1146036622 17:29412469-29412491 CAGTATAAGCTGAAGCAGTTGGG - Intronic
1147555144 17:41473919-41473941 CTGTTTCAACAAAAGCAGATAGG + Intergenic
1148640733 17:49185367-49185389 CAGCCTCAGCTGGAGCAGCTGGG - Intergenic
1149072185 17:52556371-52556393 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1150470196 17:65430786-65430808 GAGTTCCAGCAGAAGCAGCTGGG + Intergenic
1151584975 17:75003422-75003444 CTGCTGCAGCTCCAGCAGCTCGG - Exonic
1152495922 17:80671332-80671354 GTGTTCCTGCTGAAGCATCTCGG + Intronic
1155544781 18:26903809-26903831 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1156910809 18:42409133-42409155 AGGTTTGAGCTGGAGCAGCTGGG + Intergenic
1159414877 18:68132731-68132753 ATCTGTCAGCTGGAGCAGCTTGG - Intergenic
1160199070 18:76781199-76781221 CTGTTTAAATGGAAGCAGCTAGG + Intergenic
1160356404 18:78230943-78230965 CAGTTTCAGGTGAGGCACCTAGG - Intergenic
1162296305 19:9816065-9816087 CAGCTACAGCTGGAGCAGCTAGG + Intronic
1163487967 19:17600355-17600377 CTGTTTTAAATGTAGCAGCTGGG - Intergenic
1164809682 19:31146445-31146467 CTGTCTCAGCAGGGGCAGCTTGG - Intergenic
1165818981 19:38662459-38662481 TCTTTCCAGCTGAAGCAGCTGGG - Intronic
926203792 2:10820711-10820733 CTGTATCAGCGGCACCAGCTGGG + Intronic
927992083 2:27455020-27455042 CTGTTTCTGCTAATGTAGCTGGG - Intronic
930073309 2:47386563-47386585 CTGTTTCAGATAAAGGAGATGGG + Exonic
931147022 2:59530151-59530173 CTGTTTCAGAAGAGGAAGCTGGG - Intergenic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
933548159 2:83740794-83740816 CAGCTGGAGCTGAAGCAGCTAGG + Intergenic
934118229 2:88815670-88815692 CTGCTGGAGCTGGAGCAGCTGGG - Intergenic
934610134 2:95729440-95729462 CTGTTTCAGCTGGGGTAGCCTGG + Intergenic
939667088 2:144965427-144965449 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
939957191 2:148536926-148536948 TTGTGTAAGCTGAAGCAGCTGGG + Intergenic
940359999 2:152786889-152786911 TGGTTGGAGCTGAAGCAGCTTGG + Intergenic
940533131 2:154905024-154905046 CGGCTGGAGCTGAAGCAGCTGGG + Intergenic
942849872 2:180471918-180471940 CTGTGTCACCTGAAGCACCAGGG + Intergenic
943223530 2:185140192-185140214 CAGGTAGAGCTGAAGCAGCTGGG + Intergenic
943423299 2:187697651-187697673 CGGATGGAGCTGAAGCAGCTAGG - Intergenic
943475672 2:188352315-188352337 GTGTTCCAGCTCATGCAGCTAGG - Intronic
943485939 2:188481543-188481565 GTCTGTCAGCAGAAGCAGCTTGG + Intronic
944370345 2:198974732-198974754 CAGATTCAGCTAAAGCAGGTAGG - Intergenic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
946184505 2:217972175-217972197 ATGTTACAGATGAAGAAGCTGGG + Intronic
1169221115 20:3823627-3823649 CTTTTTCAGCCCAAGGAGCTGGG + Intronic
1171113241 20:22502890-22502912 TTGTTACAGCTGCAGCAGGTTGG - Intergenic
1173111742 20:40197438-40197460 CAGTTTCCGCTGAAGCACTTGGG - Intergenic
1173464795 20:43272202-43272224 CTCTGTCAACTGAAGCAGCTTGG + Intergenic
1173636107 20:44559496-44559518 CTGTTTTAGCTGAAGCAGCCAGG + Intronic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1175055669 20:56195384-56195406 GTGTTCCAGCTCAAGCAGCCAGG + Intergenic
1175103895 20:56600277-56600299 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
1176663969 21:9667122-9667144 ATGTTCCAGCTCAAGCAGCCGGG + Intergenic
1177031989 21:15992308-15992330 ATGTTTCAGCTCAAGCAGTCAGG + Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1177394116 21:20511037-20511059 CGGATGGAGCTGAAGCAGCTGGG + Intergenic
1177496166 21:21894898-21894920 CTACTGGAGCTGAAGCAGCTGGG + Intergenic
1178066539 21:28910163-28910185 CTGTTTAAGATGATGAAGCTGGG - Intergenic
1179913829 21:44463860-44463882 GTGGTTCTGCTGAAGCAGCCTGG + Intergenic
1180030909 21:45206949-45206971 CTGCTGCTGCTGAATCAGCTCGG - Intronic
1180151286 21:45949605-45949627 ATGTTCCAGCAGAAGCATCTGGG + Intergenic
1183215576 22:36477513-36477535 CTTTTTCAGATGAAGAAACTAGG - Intronic
1183811159 22:40258812-40258834 CTGTTTCAACTGAAGAAATTTGG - Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184588451 22:45463806-45463828 CAGCTACAGCTGAAGCTGCTGGG + Intergenic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1185250309 22:49798284-49798306 GTGCTTTAGCTGAAGGAGCTGGG - Intronic
950764088 3:15260422-15260444 CTGGGTCAGCTGAAAGAGCTTGG + Intronic
950990682 3:17434477-17434499 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
951937016 3:28033189-28033211 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
952025085 3:29070671-29070693 GTGTATCAGATTAAGCAGCTTGG + Intergenic
952141140 3:30480371-30480393 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
952480248 3:33753902-33753924 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
952504550 3:33995995-33996017 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
952589329 3:34932177-34932199 CTGCTAGAGCTGAAACAGCTGGG - Intergenic
954646064 3:52132285-52132307 CTGTTTCAGATGAACAAGATGGG + Intronic
955655386 3:61239995-61240017 CTGTTGCAGATGGAACAGCTGGG - Intronic
957374292 3:79336380-79336402 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
957857263 3:85894731-85894753 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
957982258 3:87525442-87525464 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
958482050 3:94654815-94654837 ATGTTCCAGCTCAAGCAGCCAGG - Intergenic
958528366 3:95291813-95291835 TGGCTGCAGCTGAAGCAGCTAGG - Intergenic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
960224908 3:115157798-115157820 CAGATGGAGCTGAAGCAGCTGGG - Intergenic
960359205 3:116690253-116690275 CTGTTTTATATGAAGCAGCATGG - Intronic
961012749 3:123447407-123447429 CAGTTCCTGCTGAAGCAGGTAGG - Exonic
961503838 3:127356966-127356988 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
962066980 3:131991838-131991860 CAGCTGGAGCTGAAGCAGCTTGG - Intronic
962850101 3:139301862-139301884 CTGTTAGTGCTGATGCAGCTGGG - Intronic
963395731 3:144731018-144731040 GTGTTCCAGCTCAAGCAGCCAGG - Intergenic
963404438 3:144844332-144844354 CCGCTGGAGCTGAAGCAGCTGGG + Intergenic
963515810 3:146306625-146306647 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
963671588 3:148258376-148258398 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
965275492 3:166677217-166677239 ACGTTGGAGCTGAAGCAGCTGGG + Intergenic
967406176 3:189118624-189118646 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
968111831 3:196054607-196054629 CTGCCTCAGCAGAAGTAGCTGGG + Intronic
970678299 4:18477473-18477495 CAGTGGAAGCTGAAGCAGCTGGG + Intergenic
971740179 4:30509358-30509380 GTGTTCCAGCTCAAGCAGGTAGG - Intergenic
971755486 4:30702417-30702439 ATGTTTCAGCTCAAGCAGTTAGG - Intergenic
971928517 4:33047553-33047575 CTGTCTCAGCTGATAGAGCTGGG - Intergenic
972805330 4:42523985-42524007 CAGTTCCAGCTGAAACAGATAGG + Intronic
972862818 4:43191814-43191836 ATGTTACAGATGAAGCAGTTGGG - Intergenic
974101475 4:57422267-57422289 CAGCTAGAGCTGAAGCAGCTGGG - Intergenic
975983495 4:80183918-80183940 CGGTCTCTGCTGCAGCAGCTGGG - Intronic
976287592 4:83385200-83385222 CAGTTGGAGCTGGAGCAGCTGGG + Intergenic
976503153 4:85815065-85815087 CAGTCACAGCTGGAGCAGCTGGG + Intronic
976635957 4:87286712-87286734 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
977197526 4:94081504-94081526 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
977356419 4:95952658-95952680 CAGTTGGAGCTGAAACAGCTGGG + Intergenic
979300720 4:119083803-119083825 ATTTTACAGATGAAGCAGCTGGG + Intergenic
979948212 4:126860499-126860521 CGGCTGCAGCTGGAGCAGCTGGG + Intergenic
980153733 4:129080004-129080026 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
980335538 4:131468846-131468868 CAGCCACAGCTGAAGCAGCTTGG - Intergenic
980559979 4:134460243-134460265 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
980801111 4:137751346-137751368 CAGTTTCAGCCGGAGTAGCTGGG - Intergenic
980881177 4:138711263-138711285 CTGTTTTGGTTAAAGCAGCTAGG - Intergenic
980915965 4:139033557-139033579 CTGCCTCAGCCTAAGCAGCTGGG - Intronic
981242370 4:142493010-142493032 CAGCTGAAGCTGAAGCAGCTGGG - Intronic
982349108 4:154395373-154395395 CTGTTTCAGCTGAAGGTTCTTGG + Intronic
982458581 4:155639459-155639481 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
982570729 4:157048115-157048137 CTGTCTCAGCTGAAGAAAATTGG + Intergenic
983020483 4:162670105-162670127 CGGCTGGAGCTGAAGCAGCTGGG + Intergenic
983889461 4:173015968-173015990 ATGCTGGAGCTGAAGCAGCTGGG - Intronic
984196585 4:176664688-176664710 CTGTTTCTGCAGAAACACCTGGG - Intergenic
984436739 4:179719032-179719054 CTGCTAGAGCTGGAGCAGCTGGG + Intergenic
985409425 4:189667802-189667824 ATGTTCCAGCTCAAGCAGCCGGG + Intergenic
985608994 5:876096-876118 CTCTTCCAGCTGAAGCAGGTGGG - Exonic
986557651 5:9027334-9027356 CGGCTGGAGCTGAAGCAGCTGGG - Intergenic
987677811 5:21097811-21097833 CTGTTTCAGCTGTTGCTGCCAGG + Intergenic
987735303 5:21833776-21833798 CTGTTTCAACTGACATAGCTTGG - Intronic
987909425 5:24122484-24122506 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
988236458 5:28551236-28551258 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
988353532 5:30142989-30143011 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
988989075 5:36651595-36651617 GGGTTTCAGGTGAAGAAGCTGGG - Intronic
989218323 5:38927533-38927555 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
989394858 5:40943167-40943189 CTGTTTCAGCTTAGGCTTCTTGG - Intronic
989399430 5:40993100-40993122 TGGTTGGAGCTGAAGCAGCTGGG + Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
990986834 5:61648539-61648561 CTATTTCAGCTGGAGCAGCCAGG + Intronic
991600652 5:68348707-68348729 CTGTTGGAGCTGGAGCAGCCTGG - Intergenic
992355988 5:75984008-75984030 CAGCTTCAGCTGGAGTAGCTGGG - Intergenic
994136814 5:96297502-96297524 CTGTTTCATGTCAAGCATCTAGG - Intergenic
994276415 5:97843773-97843795 CTGTGCCAGCTGGAGAAGCTGGG - Intergenic
994981041 5:106875457-106875479 GTCTTTGAGCTGAAGCACCTGGG + Intergenic
996046004 5:118873959-118873981 CTGTTGCAACTGCTGCAGCTTGG + Intronic
996193632 5:120576646-120576668 CTGTCCCAGCTCAAGCAGCCAGG - Intronic
996774761 5:127121315-127121337 AAGTCACAGCTGAAGCAGCTGGG + Intergenic
996969254 5:129343855-129343877 TTGTTCCAGCTGAGGGAGCTGGG + Intergenic
997020120 5:129990316-129990338 GTGTTTCAAGTCAAGCAGCTGGG + Intronic
998354999 5:141527596-141527618 CTTTTTCATCTGTGGCAGCTGGG + Exonic
998756953 5:145391402-145391424 CTGCTAGAGATGAAGCAGCTGGG + Intergenic
1000784618 5:165528453-165528475 CGGCTGGAGCTGAAGCAGCTGGG - Intergenic
1001476904 5:172057156-172057178 CTGCTTCAGCTCAAGGGGCTAGG - Intronic
1001940883 5:175738670-175738692 ATTTTACAGCTGAAGCTGCTTGG + Intergenic
1002088896 5:176793066-176793088 TTGTTGCAGCGGCAGCAGCTCGG + Intergenic
1003230058 6:4243667-4243689 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004558879 6:16728291-16728313 TGGTTTGGGCTGAAGCAGCTGGG + Intronic
1004691961 6:17999845-17999867 ATGTCTCAGCTCAAGCAGCCAGG + Intergenic
1007561274 6:42810338-42810360 CGATTTCACCTGAAGAAGCTTGG + Exonic
1007909487 6:45499256-45499278 ATGTTTCAGGTGGGGCAGCTGGG + Intronic
1008541415 6:52549553-52549575 CTGTTTCACATGCAGGAGCTTGG - Intronic
1009389649 6:63130549-63130571 CTGTTCCAGTGGAGGCAGCTGGG + Intergenic
1009582436 6:65553206-65553228 CTGTTTCAGATGAAGCCACTTGG - Intronic
1010061226 6:71625345-71625367 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1010769491 6:79812240-79812262 CTGTTTGAAGGGAAGCAGCTTGG - Intergenic
1010774842 6:79873137-79873159 ATGTTTCAGTTGCAGCAGCAGGG - Intergenic
1010900529 6:81422663-81422685 CGGCTGGAGCTGAAGCAGCTGGG - Intergenic
1011264101 6:85497498-85497520 CGGTTGGAGCTAAAGCAGCTGGG + Intergenic
1011933029 6:92737867-92737889 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1012064906 6:94537678-94537700 CGGCTGGAGCTGAAGCAGCTGGG + Intergenic
1013193331 6:107822850-107822872 CTGTTTGAGCAACAGCAGCTGGG - Intronic
1013688069 6:112609180-112609202 CAGTCACAGCTGGAGCAGCTGGG - Intergenic
1014895186 6:126892690-126892712 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1015239583 6:131008213-131008235 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
1015815659 6:137208522-137208544 CAGTCACAGCTGGAGCAGCTGGG - Intronic
1016284989 6:142462890-142462912 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1016592852 6:145765764-145765786 CAGTGGGAGCTGAAGCAGCTGGG - Intergenic
1016893536 6:149031245-149031267 CTGGTTCAGCTGTAGCTACTGGG + Intronic
1017277590 6:152588152-152588174 CTGTATCTGATGAAGCAGCTGGG - Intronic
1018131379 6:160735151-160735173 CTTTTTCTGCAGAAGCATCTTGG + Intronic
1019044157 6:169130279-169130301 ATGTTCCAGCTCAAGCAGCCAGG + Intergenic
1019605523 7:1908164-1908186 CAGTTCCAGCTGCAGCAGCCTGG - Intronic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1020307309 7:6844876-6844898 CTGTTTTTGCTTAAGCGGCTGGG + Intergenic
1021020804 7:15596206-15596228 CTGATGCAGCTGAAGGAGCAAGG - Intergenic
1021112583 7:16712492-16712514 CTGTTCCTGCTGAAGGAGCTGGG - Intergenic
1021281326 7:18722205-18722227 CTTTTTCAGCTGATTCACCTGGG - Intronic
1022290509 7:28998253-28998275 CATTTCCAGTTGAAGCAGCTGGG - Intronic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1027446522 7:78280014-78280036 ATGTTTCAGCTGGTGAAGCTGGG - Intronic
1028995413 7:97094816-97094838 CTGCTTCAGCTCTGGCAGCTGGG - Intergenic
1030625046 7:111835764-111835786 ATTTTTCAACAGAAGCAGCTGGG + Intronic
1030722408 7:112885110-112885132 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1031170879 7:118290794-118290816 CTGTTAGAGCTGAAGCAGCTGGG - Intergenic
1031396945 7:121285198-121285220 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1033303344 7:140206028-140206050 CTGTTTGATCTGAGGCTGCTTGG - Intergenic
1033532323 7:142277224-142277246 GTTTATCAGCTGAAGGAGCTTGG - Intergenic
1033858361 7:145593955-145593977 TTGTCTCAGCTCAAGCAGCCAGG + Intergenic
1034406192 7:150903795-150903817 CTGTTTCCGCTGAAGCGGCCGGG + Intergenic
1034904828 7:154934672-154934694 CAGCTAGAGCTGAAGCAGCTGGG + Intronic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1039082353 8:33745482-33745504 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1040972084 8:53146318-53146340 CAATTTCAGGTGAAGTAGCTTGG - Intergenic
1044127038 8:88471699-88471721 TGGTTGGAGCTGAAGCAGCTGGG + Intergenic
1044209503 8:89534262-89534284 CTGATTCAGCTAAATCAGGTTGG - Intergenic
1044576247 8:93772849-93772871 CCGTTTCAGCTAAAAAAGCTTGG - Intronic
1045675847 8:104607482-104607504 CTGCCACAGCTGATGCAGCTGGG - Intronic
1046689609 8:117267823-117267845 CAGCTACAGCTGGAGCAGCTGGG + Intergenic
1047254972 8:123207605-123207627 CGGCTGCAGCTGGAGCAGCTGGG + Exonic
1049796841 8:144500869-144500891 GTGCTTCAGCTCCAGCAGCTTGG - Exonic
1051986580 9:23096509-23096531 TGGCTACAGCTGAAGCAGCTGGG - Intergenic
1052268715 9:26604325-26604347 TTGTTTCAGCTAAAGCAGTCAGG - Intergenic
1052386149 9:27825623-27825645 CTGAGACAGCTGAAGCACCTGGG + Intergenic
1052702201 9:31950836-31950858 CGGCTGGAGCTGAAGCAGCTTGG + Intergenic
1053156638 9:35785397-35785419 CTGTTTCATCTGGAGCAGCTGGG + Intergenic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1053619627 9:39802285-39802307 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1054264531 9:62905158-62905180 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1055774393 9:79752166-79752188 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1055859452 9:80730736-80730758 CTGGTTCAGCTTAGGCACCTGGG + Intergenic
1056616400 9:88170854-88170876 CTGCCTCAGCTTCAGCAGCTTGG + Intergenic
1056735321 9:89204768-89204790 CTGTCTCTCCTGGAGCAGCTGGG + Intergenic
1057642220 9:96835571-96835593 CTGTTTCAGCTGAAGCAGCTAGG - Intronic
1058419210 9:104818757-104818779 CTGTTTCTGAAGAACCAGCTGGG - Exonic
1058644874 9:107121704-107121726 CAGTCTGAGCTGAGGCAGCTTGG + Intergenic
1062312390 9:135945888-135945910 CTGGTTCAGCTGAAGGGCCTTGG + Exonic
1203662131 Un_KI270753v1:54630-54652 ATGTTCCAGCTCAAGCAGCCGGG - Intergenic
1189295198 X:39912964-39912986 CGGTGTCAGCTGGGGCAGCTGGG + Intergenic
1190531836 X:51386357-51386379 TGGTTGGAGCTGAAGCAGCTGGG + Intergenic
1190725131 X:53184858-53184880 CTTTGTTAGTTGAAGCAGCTAGG + Intergenic
1193008108 X:76643837-76643859 TGGTTGGAGCTGAAGCAGCTGGG - Intergenic
1193027096 X:76856152-76856174 GTGCTGGAGCTGAAGCAGCTGGG + Intergenic
1193466466 X:81853325-81853347 CAGCTGCAGCTGGAGCAGCTGGG + Intergenic
1194554244 X:95337729-95337751 CAGCTAGAGCTGAAGCAGCTGGG + Intergenic
1194582804 X:95697437-95697459 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1194864896 X:99053806-99053828 CAGTCACAGCTGGAGCAGCTGGG - Intergenic
1194920580 X:99759913-99759935 TGGTTAGAGCTGAAGCAGCTGGG - Intergenic
1195608380 X:106835322-106835344 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1195618574 X:106931667-106931689 CTGGTTAAGCTGAATCAGGTAGG - Intronic
1195838811 X:109149941-109149963 CAGCTTGAGCTGAAGCAGCTGGG - Intergenic
1196512803 X:116532259-116532281 CTGCTGGAGCTGAAGCAGCTAGG + Intergenic
1197594406 X:128449257-128449279 CAGCTGGAGCTGAAGCAGCTAGG + Intergenic
1197875978 X:131107164-131107186 ATGTTCCAGCTGAAGTAACTAGG - Intergenic
1198566043 X:137906630-137906652 CGGCTAGAGCTGAAGCAGCTGGG - Intergenic
1198629283 X:138616901-138616923 CAGCTGAAGCTGAAGCAGCTGGG + Intergenic
1198947070 X:142027161-142027183 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1199003014 X:142662840-142662862 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1199113300 X:143959576-143959598 CAGCCACAGCTGAAGCAGCTGGG + Intergenic
1199139207 X:144289982-144290004 CAGTTGAAGCTGGAGCAGCTGGG - Intergenic
1199185500 X:144910793-144910815 CAGCTTGAGCTGAAGCAGCTGGG + Intergenic
1199337963 X:146642159-146642181 CTGTTGGAGCTAAAGCATCTGGG - Intergenic
1199346521 X:146747054-146747076 CAGCTGTAGCTGAAGCAGCTGGG + Intergenic
1199530864 X:148846221-148846243 GAGTTCCAGCTGAAGCAGGTAGG - Intronic
1201978673 Y:19882348-19882370 TGGTTGGAGCTGAAGCAGCTGGG + Intergenic