ID: 1057642489

View in Genome Browser
Species Human (GRCh38)
Location 9:96837967-96837989
Sequence CTTTGAAAGGCCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057642489_1057642495 -8 Left 1057642489 9:96837967-96837989 CCGTCCACCTTGGCCTTTCAAAG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
Right 1057642495 9:96837982-96838004 TTTCAAAGTGTTGGGATTATAGG 0: 19
1: 501
2: 8482
3: 80872
4: 364770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057642489 Original CRISPR CTTTGAAAGGCCAAGGTGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr