ID: 1057644528

View in Genome Browser
Species Human (GRCh38)
Location 9:96860257-96860279
Sequence CCTGGGGCCTTGAGTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057644520_1057644528 11 Left 1057644520 9:96860223-96860245 CCTGGCTGGCTTCACTACCTGCT 0: 9
1: 37
2: 130
3: 330
4: 809
Right 1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG 0: 1
1: 0
2: 4
3: 23
4: 183
1057644523_1057644528 -6 Left 1057644523 9:96860240-96860262 CCTGCTAATTGGAGAGCCCTGGG 0: 1
1: 0
2: 30
3: 245
4: 684
Right 1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG 0: 1
1: 0
2: 4
3: 23
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057644528 Original CRISPR CCTGGGGCCTTGAGTGAAAT AGG Intronic
900195379 1:1373175-1373197 CCTGGGGCCCTGAGTGGACGTGG - Intergenic
904577461 1:31514236-31514258 CCTGGGGCCTTGAATGGCAGCGG - Intergenic
906190731 1:43898124-43898146 CCTAGGGGCTAGAGTGAAAGTGG - Intronic
912682919 1:111740170-111740192 CCTGGGGCCTTCAGTGGGGTGGG + Intronic
912871672 1:113312077-113312099 CCTAGGGCCTTGAGTGAATGTGG + Intergenic
913077588 1:115354065-115354087 CTTTGGGCCTTAAGTGAAAAAGG + Intergenic
913098350 1:115540642-115540664 CCTGGGCCCTTCAGGCAAATGGG + Intergenic
917300538 1:173569982-173570004 CCTTGGGCCTTAAGTGAACATGG - Intronic
917469383 1:175313719-175313741 CCTGGGGCCATGTGTAAAACAGG - Intergenic
922719947 1:227895255-227895277 CTTGGGGCCTTGGGGGAGATGGG + Intergenic
1064465848 10:15581074-15581096 CCTGGGGCCTTGAATCACAATGG + Intronic
1065457149 10:25918615-25918637 TCTGTGACATTGAGTGAAATAGG + Intergenic
1066011609 10:31199547-31199569 CCTTGGGACTTTAGGGAAATTGG + Intergenic
1066708329 10:38204482-38204504 CCCAGGGCCTTGAGCAAAATAGG + Intergenic
1066800103 10:39177957-39177979 ATTGAGGCCTTCAGTGAAATAGG + Intergenic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1067777887 10:49176234-49176256 CTAGGGGCCATGAGTGAAATGGG + Intronic
1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG + Intergenic
1072426636 10:95335954-95335976 CCTGGGGCCCTGACTGACATGGG - Intronic
1073736742 10:106356297-106356319 CTTGTGGCCTTGAATCAAATGGG - Intergenic
1074236587 10:111590763-111590785 CCAGGGGACTTGTGTGAAAATGG - Intergenic
1075326385 10:121535387-121535409 CCTGGGGCCCCTAGTGAATTGGG - Intronic
1076401840 10:130190007-130190029 GCTGCGGCCTTGTGTGAATTTGG + Intergenic
1077359033 11:2132445-2132467 CCTTGGACTTTGAGTCAAATTGG - Intronic
1077516877 11:3007405-3007427 CCTTGGGGCTTGAGTGTAAATGG - Intronic
1078842504 11:15091872-15091894 CCTGGGGCCTTGAGTGTTCTAGG + Intergenic
1081190623 11:40099841-40099863 CCAGAAGCCCTGAGTGAAATGGG + Intergenic
1082307037 11:50591762-50591784 CCTGAGGCCTACAGTGAAAAAGG + Intergenic
1083953566 11:65970474-65970496 GCTGGGGCCTAGAGTGCAAGTGG + Intronic
1085261819 11:75210062-75210084 CCTGGGCTCTTGAGTGACCTTGG - Intergenic
1087910638 11:103749795-103749817 CCTGTGGCCTTGGTTGAATTTGG - Intergenic
1089626634 11:119755138-119755160 CCTGGGGACTTCTGTGAATTAGG + Intergenic
1090873968 11:130772717-130772739 CCTGGAACTCTGAGTGAAATCGG - Intergenic
1093259418 12:16917390-16917412 CCTTGGTCCTTGAGTGAAATTGG - Intergenic
1094685710 12:32712230-32712252 ACTTGGGCTTTTAGTGAAATGGG - Intronic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1097383630 12:58923379-58923401 CCTGGGGGTTAGAGTGAAAATGG - Intergenic
1099347631 12:81522940-81522962 CCTGGGTCCTTGAGTGAATGTGG - Intronic
1100360704 12:93877339-93877361 CCTAGGGCTTTGAGTGAACATGG - Intronic
1100741439 12:97597612-97597634 ACAGGGGCCTTGAGGTAAATCGG + Intergenic
1102467826 12:113140642-113140664 CCTGGGGCTCTCAGTAAAATAGG + Intergenic
1102940169 12:116933958-116933980 CCTTGGGATTTTAGTGAAATTGG + Intronic
1104625741 12:130352773-130352795 CTTAAGGCCTTGGGTGAAATAGG + Intronic
1104743371 12:131194696-131194718 CCTGGGGATTTGTGTGTAATGGG + Intergenic
1105295659 13:19086271-19086293 CCTGGGGCCCTGAGAGGAAAGGG + Intergenic
1107802461 13:44121648-44121670 TGTGTGGCCTTGAATGAAATGGG - Intergenic
1113127319 13:106993935-106993957 CCTGTGGCATTGAGTGACTTTGG + Intergenic
1114306760 14:21430782-21430804 CCAGGTGACTTGAGTGAAAGGGG - Exonic
1115470162 14:33760279-33760301 TCTGGGGCCCCGAGTAAAATTGG - Intronic
1116108886 14:40549969-40549991 TCTGGGGGCTTGATAGAAATTGG - Intergenic
1116118229 14:40685268-40685290 CCTGGGGCCTTGAATAAGACAGG - Intergenic
1117031670 14:51678004-51678026 CTTGGAGCCTAAAGTGAAATGGG - Intronic
1117866606 14:60156098-60156120 ACTGGAGCCTCGAGTGGAATTGG - Exonic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1122004228 14:98688741-98688763 GCTGGGGCCTTGAATGAACAGGG + Intergenic
1202897585 14_GL000194v1_random:19186-19208 CCTGGGGCCTTGAGTTTTACTGG - Intergenic
1125238919 15:37550516-37550538 CCTGGGGCCTTGAATGGCAGTGG - Intergenic
1125276960 15:38003715-38003737 CCTTGGGCCTTGAGTGAACATGG - Intergenic
1125579154 15:40773612-40773634 CTTGGGGCCTAGAGTGAGCTTGG - Intronic
1128336604 15:66790238-66790260 CCTGGGCCCTAGAGTGAAGAGGG - Intergenic
1129960025 15:79675753-79675775 TCTGGGGCCTTGAGGGAACTGGG - Intergenic
1130765384 15:86865336-86865358 CGTGGGGCTTTGAGTCAAAATGG - Intronic
1130905302 15:88235815-88235837 CCTGGGGCTTTGAGTCAAACAGG + Intronic
1132539829 16:503525-503547 CCTGGGGCCTTGAATGGAATGGG + Intronic
1137695762 16:50460995-50461017 CCTGGGGCCAGGAGAGCAATTGG - Intergenic
1137793612 16:51196299-51196321 CCTGGAGCCCTGAGTGAAATAGG + Intergenic
1139331774 16:66197950-66197972 CCAGCGTCCTTGAGTGCAATAGG + Intergenic
1139559794 16:67734790-67734812 ACAGGGGCCTAGAGTGAAGTGGG + Intronic
1140419601 16:74807569-74807591 CCTGGGGCCTTGAATGGCAGCGG - Intergenic
1141950860 16:87338570-87338592 CGTGGGTCCTTGTGAGAAATGGG - Intronic
1142024099 16:87803274-87803296 CCTGGGGCCTGGCCTGGAATTGG - Intergenic
1142247555 16:88976879-88976901 CCTGCAGCCTTGAGGGAAAGAGG + Exonic
1144960555 17:19041968-19041990 CCTGGGGCCTGGCGTGCAGTGGG - Intronic
1144974605 17:19132556-19132578 CCTGGGGCCTGGCGTGCAGTGGG + Intronic
1145391818 17:22461016-22461038 CTTGGGGCCTTGACTGCACTGGG - Intergenic
1146749726 17:35367874-35367896 CCTGGGGCATGGGGAGAAATGGG - Intronic
1147190271 17:38734334-38734356 CCTGGGGCCTAGAGTGGAAGTGG - Exonic
1147637142 17:41971029-41971051 GATGGGCCCCTGAGTGAAATGGG + Intronic
1148582129 17:48751506-48751528 CCTGGGGCCTTAACTCACATGGG + Intergenic
1149075633 17:52594348-52594370 CCCTGGGCCTTGAGTGAACATGG - Intergenic
1150267248 17:63839463-63839485 CCTGGGGCCCTGAGTGAGCCAGG - Intronic
1151351042 17:73532386-73532408 CCCCAGGCCTAGAGTGAAATTGG + Intronic
1152035227 17:77868200-77868222 TCTGGGGGCTTGACTGAAATTGG - Intergenic
1152641104 17:81449605-81449627 CCTGGGGCCTTCAGTGGAAGGGG + Intronic
1161995220 19:7707586-7707608 CCTGGGGCCTTGAGGGGAGGGGG - Intergenic
1162222411 19:9189128-9189150 CGTGGGGCCTTGAGGGTGATAGG + Intergenic
1165057907 19:33190377-33190399 CCTGGGGCCAGCAGTGAAAGAGG - Intronic
1165952610 19:39482707-39482729 CCTGGGTCTTTGAGAGAAATGGG - Intronic
1167452503 19:49580433-49580455 CCTGGGGTCTTGAGGGAGACTGG - Intronic
927471941 2:23384098-23384120 CCTGAGGCCTTGCTAGAAATTGG - Intergenic
927827561 2:26319183-26319205 CCTGTGACTCTGAGTGAAATGGG + Intronic
930041433 2:47128350-47128372 CTTTGGGCCTTGAGTGAACATGG - Intronic
933097934 2:78211083-78211105 CCTTGGGCATTAAGTGAAATCGG + Intergenic
935229219 2:101081370-101081392 CCCATGGTCTTGAGTGAAATGGG - Intronic
936284754 2:111173390-111173412 CCAGGAGCCTAGAGTGAGATTGG + Intergenic
936795175 2:116195637-116195659 CTTGGGTCCTTGAGTGAACATGG - Intergenic
937363080 2:121242542-121242564 CCTGGGGCCCTGGGTGAGGTGGG - Intronic
937381626 2:121382743-121382765 CATGGGGCCTTAATTCAAATCGG + Intronic
938490708 2:131759527-131759549 CCTGGGGCCTTGAGTTTTACTGG + Intronic
939206756 2:139115764-139115786 CCTGGAGCATTGAGGGAACTTGG + Intergenic
940568880 2:155405016-155405038 CCTGGTCCCTTAAGTGAACTGGG - Intergenic
942294956 2:174508136-174508158 CCTTGGGCCTTGAGTGAACATGG + Intergenic
942605198 2:177683317-177683339 CCTGGGCCCTTCTGTGTAATTGG - Intronic
942734795 2:179097308-179097330 CCTGTGGCCTGGAGGGACATGGG - Intergenic
944586632 2:201178851-201178873 CCTGGGGCCTTGAATGGCAATGG + Intergenic
946026854 2:216677029-216677051 CCTGGGTCTTTCCGTGAAATGGG - Intronic
946163547 2:217850089-217850111 CCTGGAGTCTTGAGTGGTATGGG - Intronic
946224935 2:218259444-218259466 CCTGGGGCCTGGACAGAAGTGGG - Intergenic
946509001 2:220334452-220334474 CATTGGGCCTTGAGTGAATATGG - Intergenic
948757942 2:240170002-240170024 CCTGGGGTCCTGAGTGAAGGAGG + Intergenic
948846059 2:240683305-240683327 CCTGGGGCCCTCACTGAGATGGG - Intergenic
948847797 2:240691424-240691446 CCTGGGGCCCTCACTGAGATGGG + Intergenic
1168981684 20:2009414-2009436 CCTGGGCCTTAGAGTCAAATGGG + Intergenic
1170614264 20:17936419-17936441 ACTGGGGCTTTGAGTCAAACAGG + Intergenic
1170905821 20:20514585-20514607 GCTGGGGCATGGAGTGGAATGGG - Intronic
1171474070 20:25394077-25394099 CCTTGGGTTTTGAGTGAGATGGG - Intergenic
1172772689 20:37390901-37390923 CTTGGGTCCTTCAGTAAAATTGG + Intronic
1175219036 20:57406464-57406486 CCTGGCCCCGTGTGTGAAATGGG + Intronic
1176617269 21:9035175-9035197 CCTGGGGCCTTGAGTTTTACTGG - Intergenic
1178367256 21:31998259-31998281 GCTGGGGCCATGAGGCAAATTGG + Intronic
1182098240 22:27640034-27640056 CCTGAGGCCCTCAGTAAAATGGG - Intergenic
1183233301 22:36596654-36596676 GCTGGGGACTTCAGTGAAGTGGG - Intronic
1183341004 22:37281483-37281505 CATGGGGCCTGGAGAGTAATGGG + Intergenic
1184631810 22:45787405-45787427 CCTAGTGCCTTGAGGGAAAAGGG - Intronic
949722980 3:7012223-7012245 CATGCTGCCTTGAGTGAACTAGG - Intronic
950060329 3:10065886-10065908 CCTGGAGCCTGGAGAGAAGTTGG + Exonic
950134123 3:10568616-10568638 CCTGAGGCCTTGAGTCCAAAGGG - Intronic
952387395 3:32852177-32852199 TGTGGGGCCATGAATGAAATTGG + Intronic
958198171 3:90269635-90269657 CTTGAGGCCTGTAGTGAAATAGG - Intergenic
959868497 3:111299884-111299906 CCTTGGGTCTTGAGTGAACATGG - Intronic
960611309 3:119557406-119557428 CCTGGGTTCTTGAGTTAACTTGG + Intronic
960989109 3:123299459-123299481 CCTTAGGCTTTGGGTGAAATTGG - Intronic
961792729 3:129387896-129387918 CCTGGGGCCTAGAATGGAAATGG + Intergenic
961964333 3:130887337-130887359 CCTAGGGACTTGAGTGAACATGG - Intronic
962803945 3:138914024-138914046 CCTGGGGCTTTGGGTGCAAAGGG + Intergenic
963132400 3:141870567-141870589 CCTCTGGCCCTGAGTGTAATGGG + Intergenic
965493784 3:169372855-169372877 CCTGTGGGCTTGAGTGATTTGGG - Intronic
966033735 3:175383635-175383657 GCTGGGCCCTTGAATCAAATTGG - Intronic
966401031 3:179546959-179546981 CCTGGGGCCTTGAGCAAACAGGG + Intergenic
966866883 3:184263025-184263047 CCTGGGCCCTTGAGTGAGGCTGG - Intronic
969450867 4:7272525-7272547 TCTGGGGGCTTAAGTGAAACAGG + Intronic
969680676 4:8641647-8641669 CATGGGGCCTTGAGGGACATGGG - Intergenic
972461192 4:39304378-39304400 CTTGGGGCATTGAGTTAAAGGGG - Intronic
975040554 4:69740296-69740318 CCTGGGGCCTTGCAAGCAATAGG - Intronic
983934329 4:173490419-173490441 CCTGGGCCTCTGAGGGAAATGGG - Intergenic
986064812 5:4224653-4224675 CCTGGGTCCATGTGTGAAACTGG + Intergenic
987564327 5:19564889-19564911 CCATGGGCCTTGAGTGAAGATGG + Intronic
987631501 5:20478430-20478452 CCTTGGGCCTTGAGTGAACATGG + Intronic
989486803 5:41999971-41999993 CCTGGGGAGATGAGGGAAATGGG - Intergenic
990546187 5:56823750-56823772 CCTGGTGGCTCGAGTGAAATAGG + Intronic
990579669 5:57156010-57156032 CCTGGGGTCTTGAGCGAACACGG + Intergenic
991272694 5:64803736-64803758 CATAGGGCCTTGAGTGAGTTGGG + Intronic
992398259 5:76387227-76387249 CCTGGGGCTTTGACTGAACTGGG + Intergenic
995059306 5:107796248-107796270 CCTTTGGCTCTGAGTGAAATGGG + Intergenic
1000824912 5:166033018-166033040 CCTGGGGCCTAAAGTGACAACGG + Intergenic
1002793126 6:449791-449813 GCTGAGGTCTTGAGTGACATGGG + Intergenic
1003523199 6:6876254-6876276 CCTGGGCCCTCGGGGGAAATAGG + Intergenic
1003965361 6:11247595-11247617 TCTGGGGCCTGGGGGGAAATGGG - Intronic
1006986229 6:38177427-38177449 CCTTGGTCCTTGAGTCAGATCGG - Intronic
1007166116 6:39830307-39830329 GCTGGGGCATTGCGAGAAATTGG + Intronic
1007247084 6:40470701-40470723 CCTGGGGCCTGGGGTGAGAGGGG - Intronic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1012632015 6:101482373-101482395 TATGCTGCCTTGAGTGAAATGGG + Intronic
1013415068 6:109917592-109917614 GCTGGACCCTTGAGGGAAATTGG + Intergenic
1019555967 7:1631566-1631588 CCTGTGGCCTTGGTTCAAATAGG - Intergenic
1020002347 7:4763012-4763034 CTTGGGGTCTGAAGTGAAATCGG - Exonic
1020348286 7:7188236-7188258 CCTGTGGCTCTGAGTGAAATAGG + Intronic
1021353661 7:19627782-19627804 TCTGGGGCCCTTAATGAAATTGG + Intergenic
1023025869 7:36049198-36049220 CCTGGGGCCTTAAGTGTCCTAGG + Intergenic
1023121516 7:36914031-36914053 GCTGGGGCTTTGACTGAAACTGG + Intronic
1024956595 7:54927221-54927243 CCTAGGTCCTTGAGTGAACTAGG + Intergenic
1025169913 7:56747254-56747276 CCTAGGGCTTAGAGTTAAATAGG - Intergenic
1025573183 7:62600736-62600758 TTTGGGGCCTTTGGTGAAATAGG - Intergenic
1025580539 7:62709826-62709848 ATTGGGGCCTTGGGTGAAAAAGG - Intergenic
1025701976 7:63828462-63828484 CCTAGGGCTTAGAGTTAAATAGG + Intergenic
1026791223 7:73333391-73333413 ACTGATGCTTTGAGTGAAATGGG - Intronic
1027449456 7:78313930-78313952 CCTGGGGACTTAAGTTAAAATGG + Intronic
1028995014 7:97090666-97090688 CCTGGGCCCATGAGGGAAAAAGG - Intergenic
1032359707 7:131244130-131244152 CCTGGGGAGTAGAGGGAAATCGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035246629 7:157566589-157566611 CCTGGGGCCTTTTCTGAGATTGG - Intronic
1035468010 7:159092238-159092260 GCTGGGGCCCAGAGCGAAATTGG + Intronic
1036112774 8:5922388-5922410 TCTGGGGCTGGGAGTGAAATGGG + Intergenic
1039736912 8:40342688-40342710 CCTGTATTCTTGAGTGAAATTGG - Intergenic
1043960895 8:86417116-86417138 CCTGGGGCAGACAGTGAAATTGG + Intronic
1045436432 8:102169322-102169344 CCTGGCACATTGAGGGAAATGGG - Intergenic
1047606488 8:126479882-126479904 CCTGGGTCATGGAGTGAGATGGG - Intergenic
1051839732 9:21381812-21381834 CCTGGGGCCAAGAGTGATAAGGG - Intergenic
1051992166 9:23164060-23164082 CCTAGGGCCTTGAGTGAACATGG + Intergenic
1053051237 9:34962252-34962274 CCTGGGGGCTAGATAGAAATAGG - Intronic
1053875531 9:42541037-42541059 CCTGGGGCCTTGAATGGCAGGGG + Intergenic
1053897114 9:42753596-42753618 CCTGGGGCCTTGAATGGCAGGGG - Intergenic
1054236168 9:62560687-62560709 CCTGGGGCCTTGAATGGCAGGGG - Intergenic
1056455170 9:86752723-86752745 CCTGGAGTCTTGAGAGACATGGG - Intergenic
1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG + Intronic
1057955878 9:99407472-99407494 CCATGGGGCTTGAGTGAGATCGG - Intergenic
1060282990 9:122226537-122226559 GCTGGGGCCCGGAGTGAAAGAGG - Intronic
1060283993 9:122232906-122232928 CCTTGGGCCTAGACTCAAATGGG - Intergenic
1062035201 9:134379822-134379844 CCTGGGGCCTTGTGTGGGAGGGG + Intronic
1187156259 X:16722825-16722847 CATGGGGCCTTGAGGGAGGTAGG - Intronic
1187329235 X:18320786-18320808 CCTGGGGCCCTGAGGAAAAGGGG - Intronic
1188614562 X:32141823-32141845 CTTGGGGCCTTTTGTGAAAATGG + Intronic
1189013340 X:37070141-37070163 CCTAGGGCCTTGAGTGAACATGG - Intergenic
1189875593 X:45433270-45433292 CCTTGAGCCTTGCGTAAAATAGG - Intergenic
1190323849 X:49194436-49194458 CCTGGGGCCTTGTCAGAAATGGG - Intronic
1190599683 X:52077668-52077690 CCTGGGGCTTTCACTGCAATGGG - Intergenic
1190608511 X:52170182-52170204 CCTGGGGCTTTCACTGCAATGGG + Intergenic
1194317676 X:92400804-92400826 CTTTGTGCCTTGAGTGTAATGGG + Intronic
1196512011 X:116523320-116523342 CCTAGGGCCTTTAGTGAACATGG - Intergenic
1200625854 Y:5514086-5514108 CTTTGTGCCTTGAGTGTAATGGG + Intronic
1201150663 Y:11094011-11094033 CCTGGGGCCTTGAGTTTTACTGG - Intergenic