ID: 1057646182

View in Genome Browser
Species Human (GRCh38)
Location 9:96877329-96877351
Sequence AGATGCCGCTGCGCAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057646169_1057646182 19 Left 1057646169 9:96877287-96877309 CCCAGCAACTTTCCTGGGGGCCG No data
Right 1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG No data
1057646170_1057646182 18 Left 1057646170 9:96877288-96877310 CCAGCAACTTTCCTGGGGGCCGC No data
Right 1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG No data
1057646175_1057646182 -1 Left 1057646175 9:96877307-96877329 CCGCGGGCGAAGGAACACCCCCA No data
Right 1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG No data
1057646174_1057646182 7 Left 1057646174 9:96877299-96877321 CCTGGGGGCCGCGGGCGAAGGAA No data
Right 1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057646182 Original CRISPR AGATGCCGCTGCGCAGGGAC AGG Intergenic
No off target data available for this crispr