ID: 1057654454

View in Genome Browser
Species Human (GRCh38)
Location 9:96940060-96940082
Sequence ATGTAGACACAGATTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057654448_1057654454 28 Left 1057654448 9:96940009-96940031 CCAACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654447_1057654454 29 Left 1057654447 9:96940008-96940030 CCCAACAGCTATGATTCCCTTCC 0: 2
1: 6
2: 0
3: 15
4: 141
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654450_1057654454 12 Left 1057654450 9:96940025-96940047 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654446_1057654454 30 Left 1057654446 9:96940007-96940029 CCCCAACAGCTATGATTCCCTTC 0: 2
1: 5
2: 0
3: 5
4: 141
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654452_1057654454 7 Left 1057654452 9:96940030-96940052 CCATATGATGACTGAACTCGTGT 0: 2
1: 5
2: 0
3: 1
4: 89
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654451_1057654454 8 Left 1057654451 9:96940029-96940051 CCCATATGATGACTGAACTCGTG 0: 2
1: 5
2: 0
3: 3
4: 44
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data
1057654449_1057654454 13 Left 1057654449 9:96940024-96940046 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057654454 Original CRISPR ATGTAGACACAGATTTACAT TGG Intronic
No off target data available for this crispr