ID: 1057656568

View in Genome Browser
Species Human (GRCh38)
Location 9:96958300-96958322
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
904294285 1:29507672-29507694 TGGACTAAAAGCACCAGCGCTGG - Intergenic
905660368 1:39718001-39718023 TAGAGTCACTGCACCACCGCCGG + Intronic
907923621 1:58935671-58935693 TGGAGGAAATGCAGAAAGGCTGG - Intergenic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG + Intergenic
1064546863 10:16459386-16459408 TGGAGTAGCTACAGCACTGCTGG - Intronic
1074391116 10:113058815-113058837 AGGAATAAAAGCAGCAACGCTGG - Intronic
1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG + Intronic
1076122870 10:127950277-127950299 TGCAGTTAATGCTGCAGCGCAGG + Intronic
1077721958 11:4638498-4638520 TGGAGTAACAGCAGCAGCACTGG + Intergenic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1083414139 11:62514355-62514377 TTGAGTGAAAGCAGCACCCCGGG + Intronic
1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG + Intergenic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1101227373 12:102702948-102702970 TTGAGAAAATGAAGCACCGGAGG - Intergenic
1101757075 12:107629485-107629507 TGGAGTAAATTCAGGTCCTCTGG - Intronic
1112127292 13:96481997-96482019 TGGAGTTAATGAAGCACAGAAGG - Intronic
1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG + Intronic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1122297504 14:100713666-100713688 TGGAGTAAAGACAGCACTGATGG + Intergenic
1125452782 15:39826393-39826415 TGGAGTAAAGACAGGACCCCAGG + Intronic
1126350754 15:47742698-47742720 TGGAATAGATGCAGCCCCTCAGG + Intronic
1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG + Intergenic
1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG + Intronic
1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG + Intergenic
1137241370 16:46657452-46657474 AGGAATAAATGCACCACCACAGG - Exonic
1137870507 16:51945825-51945847 TGGAGTTAATGCAACCCCGAAGG + Intergenic
1138369159 16:56510952-56510974 TGGAGTAAATGGAGAAACGATGG - Intronic
1140136338 16:72209024-72209046 TGGAGAAAAGGCAGCCACGCTGG - Intergenic
1141146465 16:81533839-81533861 TGGAGTCCATGCAGGGCCGCAGG + Intronic
1141405299 16:83787432-83787454 AGGAGTAAATGGAGCAGAGCGGG - Intronic
1149151438 17:53569048-53569070 TTGAGTAAATGCAGCACACCTGG - Intergenic
1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG + Intronic
1158297984 18:56020350-56020372 TGGAGTAAATGAAGAATCTCAGG - Intergenic
1160464424 18:79064433-79064455 TGGAGTAGATGCAGGCCAGCTGG - Intergenic
1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG + Intronic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1165962536 19:39547314-39547336 TGGAATAAATGCAGCAATGATGG - Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928253947 2:29705890-29705912 GGGAGTATATCCAGCACAGCAGG + Intronic
930154644 2:48093566-48093588 TGGAGTAAATACAGCTTTGCTGG - Intergenic
931417069 2:62091483-62091505 TGGAGTCAATCCAGAACTGCTGG + Intronic
931686160 2:64795975-64795997 TGGATGAAATGCCACACCGCAGG - Intergenic
932919908 2:75900584-75900606 TATAATAAATGAAGCACCGCCGG + Intergenic
936065954 2:109332340-109332362 AGGAGCAAGTGCAGCACCCCTGG - Intronic
936156681 2:110051517-110051539 TGGAGGAAGTTCAGCACAGCAGG - Intergenic
936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG + Intergenic
946223260 2:218247223-218247245 TGGAGTAAGTGGATCACGGCTGG - Intronic
1170117445 20:12875643-12875665 TGGAATAAATGCAGCAAAGGAGG - Intergenic
1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG + Exonic
1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG + Exonic
1181075737 22:20375548-20375570 TGGAGAAGATGCAGGACAGCCGG - Exonic
1185146617 22:49140689-49140711 TGCAGCAAATGCAGCCCGGCTGG + Intergenic
950984646 3:17348416-17348438 TGGTGGAAATGCAGAACCCCAGG - Intronic
952984130 3:38762527-38762549 TGGAGTATTTGCAGAACCGTAGG + Intronic
956339709 3:68208760-68208782 TGGAGGAAATTCTGCACAGCAGG - Intronic
958147794 3:89649253-89649275 TGGAGTTAGTGCAGAACCACAGG + Intergenic
962333320 3:134500560-134500582 TGGAGAAAAGGCAACACCGTTGG - Intronic
964503523 3:157374073-157374095 TGGAGTAAATGAATAACAGCTGG + Intronic
964644655 3:158946244-158946266 TGGAGTAAATCCAGCATAGAGGG - Intergenic
969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG + Intergenic
982719899 4:158848620-158848642 TGGACTAAATACAGCACCAGGGG + Intronic
985697813 5:1351364-1351386 TGGTGTGAATGCACCACAGCTGG + Intergenic
985961825 5:3308359-3308381 TGGTGGAAATGCAGCTCGGCAGG + Intergenic
1003873214 6:10417450-10417472 TGGCATAAATGCAGCTCGGCTGG - Intronic
1006975233 6:38094303-38094325 TGGATTAAATGCAGTACCCATGG - Intronic
1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG + Intergenic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1019359955 7:599622-599644 GGGTGTAAATGCTGCCCCGCGGG - Intronic
1021862177 7:24916827-24916849 TGGTGTAACAGCAGCACAGCTGG - Intronic
1022018217 7:26372542-26372564 TAAAGTAAATACAGCTCCGCAGG + Exonic
1025227325 7:57177109-57177131 TGGAGTGAGAGCAGCACCGTGGG + Intergenic
1025730546 7:64103169-64103191 TGGAGTGACAGCAGCACCGTGGG - Intronic
1028110741 7:86938100-86938122 TGGAGTTGATGCAACACTGCTGG + Intronic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1037788870 8:21919567-21919589 TGGAGAATGCGCAGCACCGCTGG - Intergenic
1040335943 8:46416035-46416057 AGGAGAAAAGGCAGCACTGCAGG + Intergenic
1044923863 8:97193071-97193093 TGGAGCAAGTGCAGCATGGCTGG - Intergenic
1045198294 8:99952326-99952348 TGGAGTAGATGGAGCACCTATGG - Intergenic
1050461991 9:5885052-5885074 TGGAGGAAATGGAGGACCACAGG - Intronic
1055675639 9:78657563-78657585 TGGAGTAGGTGCTGCACCCCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057872032 9:98725556-98725578 TGGAGTAAATACAGCATGGAAGG + Intergenic
1061939546 9:133876654-133876676 TGGAGGGAAGGCAGGACCGCGGG + Intronic
1062411040 9:136424530-136424552 TGGACTACAGGCAGCACCGCAGG - Intergenic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG + Intronic
1198687674 X:139244764-139244786 TGGAGGAAGTGCAGCCCTGCTGG + Intergenic
1198831158 X:140752102-140752124 TTGAGGAAAAGCAGCACCACAGG - Intergenic
1199172375 X:144746251-144746273 TGGAGTCAATCCAGAACTGCTGG - Intergenic