ID: 1057660655

View in Genome Browser
Species Human (GRCh38)
Location 9:96998526-96998548
Sequence AATTAAGCACAGGCTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057660646_1057660655 21 Left 1057660646 9:96998482-96998504 CCTTGTCTCAAGTAAATAAGGAA 0: 2
1: 1
2: 45
3: 756
4: 4072
Right 1057660655 9:96998526-96998548 AATTAAGCACAGGCTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057660655 Original CRISPR AATTAAGCACAGGCTGGGCA CGG Intronic
No off target data available for this crispr