ID: 1057663609

View in Genome Browser
Species Human (GRCh38)
Location 9:97025956-97025978
Sequence CAGTAGGCCCCGGACTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057663609_1057663619 24 Left 1057663609 9:97025956-97025978 CCAGGGCAGTCCGGGGCCTACTG No data
Right 1057663619 9:97026003-97026025 CCAGGTCTTTTTAAAATATGTGG No data
1057663609_1057663614 6 Left 1057663609 9:97025956-97025978 CCAGGGCAGTCCGGGGCCTACTG No data
Right 1057663614 9:97025985-97026007 CTTGTCCTCTTCATCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057663609 Original CRISPR CAGTAGGCCCCGGACTGCCC TGG (reversed) Intergenic
No off target data available for this crispr