ID: 1057664580

View in Genome Browser
Species Human (GRCh38)
Location 9:97034905-97034927
Sequence CCTCCCTTATGGAGGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057664580_1057664586 22 Left 1057664580 9:97034905-97034927 CCTACCACCCTCCATAAGGGAGG 0: 1
1: 0
2: 3
3: 18
4: 134
Right 1057664586 9:97034950-97034972 TCATAAACAAATGCCAAATAAGG 0: 1
1: 0
2: 3
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057664580 Original CRISPR CCTCCCTTATGGAGGGTGGT AGG (reversed) Intronic
900573273 1:3370526-3370548 CCTCTCCTCTGGTGGGTGGTGGG - Intronic
900941396 1:5800894-5800916 CTTCCCTTGTGGTGGGGGGTGGG - Intergenic
901303933 1:8218612-8218634 CCTCCTTTATGGAAGTTGGGTGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903373209 1:22850182-22850204 CCTCCCTTCTGGAGGGGGAGGGG + Intronic
907975555 1:59427910-59427932 CATCTCTTATGTAGGGTGGTGGG + Intronic
908372334 1:63495657-63495679 CTTCCCTTGTGGAGGAAGGTGGG + Intronic
912392964 1:109317563-109317585 CCTCCCTTCCTGGGGGTGGTTGG + Intronic
914437374 1:147671669-147671691 CCTCCCTGATGCAGGGAGGAGGG + Intergenic
914753359 1:150550060-150550082 TCTCCCTGCTGGAGAGTGGTTGG - Intronic
919741086 1:200982090-200982112 CCACCCTTGAGGATGGTGGTCGG + Intronic
921166925 1:212514417-212514439 CCTCCCTGATGGAAGGCAGTAGG - Intergenic
924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG + Intronic
924898410 1:248368402-248368424 CCTGCCTTATGGAGGTGGGAGGG + Intergenic
1063666107 10:8061756-8061778 CCTCTCATTTGCAGGGTGGTGGG - Intronic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1074399015 10:113126581-113126603 CCTCCCTTTTGTGGGGGGGTGGG + Intronic
1075559901 10:123460699-123460721 CCTGCCTTATGGAATATGGTGGG + Intergenic
1075856121 10:125631671-125631693 CCTCCCTTCTGGTGGGTAGGGGG + Intronic
1076481345 10:130786937-130786959 CCTGCCTTCAGGAGGGAGGTGGG + Intergenic
1077062476 11:623954-623976 CCTCCCTTGTGGATGGTTGAGGG + Intronic
1078013420 11:7591925-7591947 CTTTTCTCATGGAGGGTGGTGGG + Intronic
1078872626 11:15363147-15363169 CCTCCCTTCTGGATGGAGGTAGG + Intergenic
1079053448 11:17183846-17183868 CCTCCCAAAGGGAGGGTGCTGGG - Intronic
1080945749 11:36972088-36972110 CCTCCCTCATTGAGGGAGGAAGG + Intergenic
1081616282 11:44593297-44593319 CCTGCCTTATGGAGGGGGAAGGG - Intronic
1083343826 11:61975843-61975865 CCTCCCGTATGGAAGATGCTGGG + Intergenic
1085845320 11:80058536-80058558 CCTTCCTTATGGAGGGATGTGGG + Intergenic
1086422106 11:86646945-86646967 CCTCACTTATGAAGCTTGGTTGG - Intronic
1089326023 11:117657678-117657700 TCTCCCTTTTGGAAGCTGGTAGG + Intronic
1090580186 11:128151027-128151049 GCTCCCTGATGGATGCTGGTAGG - Intergenic
1097008790 12:55938011-55938033 TTTCCCTTCTGGAGGGTGGTCGG + Exonic
1097626795 12:62010791-62010813 CCTCCCAGATGAAGGGTGGCCGG - Intronic
1103995787 12:124829200-124829222 CCTTGCTGATGGAGGGTGCTAGG - Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1113963769 13:114140210-114140232 CCTCCCTGAAGCAGGGAGGTTGG - Intergenic
1116294481 14:43089217-43089239 CAACCCTTATGGAGGCTTGTTGG + Intergenic
1118553565 14:66985791-66985813 CTTCCTTTTTGGAGGGTGGTGGG + Intronic
1119668321 14:76500004-76500026 CCTCTCTCATTGAGGGGGGTTGG - Exonic
1121449655 14:93999074-93999096 CCTCCCCTCTGGGGGCTGGTGGG + Intergenic
1121793043 14:96713152-96713174 CCACAGTTATGGAGGGTTGTAGG - Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1134029351 16:10979311-10979333 CCTCCCTAGTGCAGGGTGGCAGG - Exonic
1134383278 16:13747901-13747923 CCCACCTTCTGGTGGGTGGTGGG + Intergenic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1137585598 16:49662393-49662415 CCTTCCTCTTGGAGGATGGTTGG - Intronic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1140255933 16:73336385-73336407 CCTCCCTGAGGGTGGGGGGTGGG - Intergenic
1143099981 17:4499464-4499486 CCTCCCTCGAGGCGGGTGGTGGG - Intronic
1143102302 17:4511220-4511242 ACTAACTTATTGAGGGTGGTGGG + Intronic
1144038611 17:11388977-11388999 TCTGCTTTCTGGAGGGTGGTGGG - Intronic
1145804785 17:27718864-27718886 CCTTCATAATGGGGGGTGGTAGG - Intergenic
1146828795 17:36048156-36048178 CCTGCCAGATGGAGGGTGGTTGG - Intergenic
1147322772 17:39656269-39656291 CCTCCCTTCTCCAGGGTGGCTGG + Intronic
1149946609 17:60934629-60934651 CCTCCCTGGTGGGGGATGGTGGG + Intronic
1151356621 17:73562452-73562474 CCTAACTTCTGGAGGGAGGTGGG - Intronic
1152073951 17:78147410-78147432 CCTTCCTTATAGAGGCAGGTGGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1159788130 18:72740443-72740465 CCTCTCCGATGGAGGGTGGGAGG - Intergenic
1165361321 19:35338590-35338612 CCTGGCTCATGGAGGGTGCTTGG + Intronic
1165409275 19:35648828-35648850 CCTCCCTTTTGGACGTTGGAGGG + Intronic
1165434487 19:35788623-35788645 CCCCCAGGATGGAGGGTGGTGGG - Exonic
1167220787 19:48196843-48196865 CCCTCCTGGTGGAGGGTGGTGGG - Intronic
1167754673 19:51404721-51404743 CCTCTCTTATGGAAGGTGGAAGG + Intergenic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
933687901 2:85157867-85157889 CCTCCCTTAAGGAGGGAAGGAGG - Intronic
936652527 2:114445233-114445255 CCTCCCTCATGGAATCTGGTTGG + Intronic
938172120 2:129088505-129088527 CCTGCCTTATGGAGAATGTTCGG + Intergenic
939808906 2:146807947-146807969 CCTCCCCTAAGGAGTTTGGTAGG - Intergenic
1168753728 20:301289-301311 CCTCCCTCCTGGAGAGTGGGGGG - Intergenic
1175983585 20:62753396-62753418 CCTCCCTTGTGGCAGGAGGTTGG + Intronic
1178181581 21:30168042-30168064 CCTCCCACCTGGAGTGTGGTTGG - Intergenic
1179170644 21:38970354-38970376 ACTGCCTTATGCAGGGTGGTGGG + Intergenic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182621248 22:31619945-31619967 CCTCCCTTTTGGAGCTGGGTTGG - Intronic
1184112153 22:42401743-42401765 CCTCCCTAGTAGATGGTGGTGGG + Intronic
1184915180 22:47564089-47564111 CCTCCCTTCTGCAGGTGGGTGGG + Intergenic
949648033 3:6120865-6120887 GCTCCTTTATGGAATGTGGTTGG - Intergenic
950580056 3:13856074-13856096 CCTACCTTCTGCAGGGTGGGAGG - Intronic
952251604 3:31661615-31661637 TCTCCCTTATGGACAGTGATCGG + Exonic
954958453 3:54542719-54542741 CCACCCAGATGGAGGGTGGTGGG + Intronic
961378954 3:126484782-126484804 CCTCCCACCTGGAGGCTGGTGGG - Intronic
967637907 3:191825825-191825847 CATCCCTTCTTGAGGGTGGAGGG + Intergenic
968223157 3:196953436-196953458 CCTGCCTTTTGGAAGGTGATGGG + Intronic
969621317 4:8280297-8280319 CCTCCCTCCTGGAGGGAGGAGGG + Intronic
973021393 4:45208314-45208336 CCTCCCAGATGAAGGGCGGTCGG - Intergenic
973197541 4:47463162-47463184 CCTCCCCCCTTGAGGGTGGTTGG - Intronic
974848737 4:67381276-67381298 CCTCCCAGATGAAGGGTGGCCGG - Intergenic
976306374 4:83564104-83564126 CCTCTATTATGGAGGCTAGTGGG + Intronic
976771911 4:88662277-88662299 CCTCCATTCTGAAGGGTGGAGGG + Intronic
978430887 4:108632057-108632079 CCTCCTTAATGGTAGGTGGTTGG - Intergenic
981907602 4:149940162-149940184 CCTACCTTATGGTGGAGGGTGGG + Intergenic
982542540 4:156692110-156692132 CCTCCCTTGTGGAACCTGGTGGG - Intergenic
985703422 5:1386997-1387019 CCTCCCCTAGTCAGGGTGGTCGG - Intergenic
986947812 5:13046241-13046263 TCTCCCTTGTGGAGGGTGGAGGG + Intergenic
987336245 5:16900509-16900531 CCTCCCTGCTGGGAGGTGGTGGG - Intronic
989646547 5:43639611-43639633 CCTCCCATATGCAGGGTGGATGG - Intronic
989648102 5:43658542-43658564 ACTCCCTTATGGTGGGTGGTGGG + Intronic
990709185 5:58563557-58563579 CCTCCCAGATGAAGGGTGGCTGG + Intergenic
994099555 5:95878460-95878482 CCTCCCTTGTGGAGGTTTCTGGG - Intergenic
995543568 5:113207443-113207465 CCTCCATCGTGGAGGGTGGGGGG + Intronic
997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG + Intergenic
997453585 5:134002412-134002434 CTTCCCTCATGGTGGGTGGATGG - Intronic
998096188 5:139396686-139396708 CCTCCCTCTTGGATAGTGGTAGG - Intronic
1001383348 5:171318222-171318244 CCTCCCTGACTGGGGGTGGTGGG - Intergenic
1001709722 5:173768505-173768527 CCTCCGTTTTGGAGAGTGGTTGG + Intergenic
1002333027 5:178458166-178458188 CCTCACTTCTGGAGGATGCTGGG + Intronic
1003511392 6:6783907-6783929 CTTACCTCATGGTGGGTGGTAGG - Intergenic
1004962004 6:20800619-20800641 CCTTCTTTTTTGAGGGTGGTGGG + Intronic
1006865733 6:37207712-37207734 CCACATTTTTGGAGGGTGGTGGG + Intergenic
1007957273 6:45929351-45929373 CCTCCCTCATGGAGGGTCCTTGG - Intronic
1009714618 6:67374647-67374669 CCTCCCTCTTGGAGAGTGGCAGG - Intergenic
1013168757 6:107617390-107617412 CCTGCCTTTTAGAGGGTGGCTGG - Intronic
1013231978 6:108167921-108167943 CCTCCTTCTTGGAGGGGGGTAGG - Intronic
1013461466 6:110378699-110378721 CCTCCCTCAGGGAGTTTGGTAGG - Intergenic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1015407642 6:132855615-132855637 CCTCCCTTCTAGAGGGTTTTAGG + Intergenic
1016287927 6:142493960-142493982 CCTCCCTGAGGGAGGAGGGTGGG + Intergenic
1019559598 7:1649364-1649386 CCTCCCTTAGGGCCGGTGCTTGG + Intergenic
1020547610 7:9553570-9553592 CTTCCCTAAAGGAGGGTGATTGG + Intergenic
1023015179 7:35961535-35961557 CATCCCTTATGGAGGGTAGTGGG + Intergenic
1023402118 7:39798030-39798052 CCTCCTTCATGGTGGGAGGTGGG + Intergenic
1024065768 7:45733157-45733179 CATCCCTTATGGAGGGTAGTGGG - Intergenic
1026185904 7:68082402-68082424 CCTCCCAGATGAAGGGTGGCTGG - Intergenic
1027539696 7:79452767-79452789 CCTCCCCTTTGGAAGGTGCTCGG - Intronic
1038303806 8:26381428-26381450 ACTCCTAGATGGAGGGTGGTGGG + Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1042956655 8:74258151-74258173 CCTACCTCATGCAGGGTGCTGGG + Intronic
1044582064 8:93833946-93833968 CCTCCCAGATGAAGGGTGGCTGG + Intergenic
1044732933 8:95246430-95246452 CCTCCCTTCAGTAGGGTGGCTGG + Exonic
1046652624 8:116854627-116854649 CCTCTCTTCTGAATGGTGGTTGG - Intronic
1046790748 8:118319207-118319229 CCTCCATTAATGGGGGTGGTGGG + Intronic
1047501083 8:125442017-125442039 CCTCTTTTTTGGGGGGTGGTGGG - Intergenic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1047697791 8:127420121-127420143 TCTACCTTATGGAGGCTGCTTGG - Intergenic
1048015266 8:130491312-130491334 CCTGCCTTGTGGGGGGTGGCGGG + Intergenic
1048947853 8:139466822-139466844 CCTCCCTTATGGACTATGCTGGG - Intergenic
1049260520 8:141636538-141636560 CCTCCCTAAAGGAGGGAGGAAGG - Intergenic
1049378837 8:142302074-142302096 TCTCCCATATGGTGGGTGGGGGG - Intronic
1055364729 9:75530515-75530537 GCTCCCTTATTTAGAGTGGTGGG - Intergenic
1056262519 9:84862946-84862968 CCTCACATCTGGAAGGTGGTTGG + Intronic
1057137052 9:92698905-92698927 ACACCCTTATGGAGGGGGGCTGG + Intergenic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1057696532 9:97326675-97326697 CCTGCCTTCTGGAGTCTGGTTGG - Intronic
1058374254 9:104305021-104305043 CCTCCCTGAAGGAGTTTGGTAGG - Intergenic
1058835182 9:108854146-108854168 GCTCCCATATTGAGGGTGGCAGG + Intergenic
1059463817 9:114452759-114452781 CCTCCCTGATGGAGGGCAGATGG + Intronic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1062508790 9:136893247-136893269 CGTCCCTTCTGTTGGGTGGTTGG + Intronic
1185659318 X:1714340-1714362 CCTCGCTGATGGGGGGTGGCTGG + Intergenic
1190706196 X:53030234-53030256 CCTCCCTGTAGGAGGGAGGTGGG + Intergenic
1199595662 X:149504344-149504366 CCTCCCTCATGGTAGGTGCTAGG + Intronic
1200096954 X:153668988-153669010 CCTCCAAAATGGAGGTTGGTGGG + Intergenic
1200875941 Y:8154966-8154988 CCTTCCTTGTGGAGGATGTTAGG - Intergenic
1201325710 Y:12755579-12755601 CCTGCCTTCTGGAGGGTTATTGG + Intronic