ID: 1057665532

View in Genome Browser
Species Human (GRCh38)
Location 9:97042099-97042121
Sequence CTGAGTAAACAAATAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057665532_1057665533 13 Left 1057665532 9:97042099-97042121 CCATTGTCTATTTGTTTACTCAG No data
Right 1057665533 9:97042135-97042157 AGCTAAGTTATTCTAACACGTGG No data
1057665532_1057665534 14 Left 1057665532 9:97042099-97042121 CCATTGTCTATTTGTTTACTCAG No data
Right 1057665534 9:97042136-97042158 GCTAAGTTATTCTAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057665532 Original CRISPR CTGAGTAAACAAATAGACAA TGG (reversed) Intergenic
No off target data available for this crispr