ID: 1057666508

View in Genome Browser
Species Human (GRCh38)
Location 9:97050024-97050046
Sequence TTGTTTTTTTAGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 608112
Summary {0: 157, 1: 67390, 2: 170537, 3: 207161, 4: 162867}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666508_1057666513 11 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data
1057666508_1057666511 -3 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666508_1057666514 23 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666514 9:97050070-97050092 GTGCCTGTAGGCCCAGCTATAGG No data
1057666508_1057666517 27 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data
1057666508_1057666515 24 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666515 9:97050071-97050093 TGCCTGTAGGCCCAGCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666508 Original CRISPR TTGTTTTTTTAGTAGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr