ID: 1057666509

View in Genome Browser
Species Human (GRCh38)
Location 9:97050025-97050047
Sequence TTTGTTTTTTTAGTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661549
Summary {0: 378, 1: 174049, 2: 223680, 3: 151716, 4: 111726}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666509_1057666511 -4 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666509_1057666517 26 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data
1057666509_1057666514 22 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666514 9:97050070-97050092 GTGCCTGTAGGCCCAGCTATAGG No data
1057666509_1057666513 10 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data
1057666509_1057666515 23 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666515 9:97050071-97050093 TGCCTGTAGGCCCAGCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666509 Original CRISPR TTTGTTTTTTTAGTAGAGAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr