ID: 1057666511

View in Genome Browser
Species Human (GRCh38)
Location 9:97050044-97050066
Sequence CAAAAATTAGCCAGGCATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435660
Summary {0: 1129, 1: 23573, 2: 70685, 3: 148357, 4: 191916}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666509_1057666511 -4 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666508_1057666511 -3 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666506_1057666511 16 Left 1057666506 9:97050005-97050027 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666505_1057666511 20 Left 1057666505 9:97050001-97050023 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916
1057666507_1057666511 11 Left 1057666507 9:97050010-97050032 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1057666511 9:97050044-97050066 CAAAAATTAGCCAGGCATAGTGG 0: 1129
1: 23573
2: 70685
3: 148357
4: 191916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666511 Original CRISPR CAAAAATTAGCCAGGCATAG TGG Intergenic
Too many off-targets to display for this crispr