ID: 1057666512

View in Genome Browser
Species Human (GRCh38)
Location 9:97050054-97050076
Sequence CAGGCACATGCCACTATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156352
Summary {0: 134, 1: 2731, 2: 12574, 3: 40765, 4: 100148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666512_1057666515 -6 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666515 9:97050071-97050093 TGCCTGTAGGCCCAGCTATAGGG No data
1057666512_1057666517 -3 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data
1057666512_1057666514 -7 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666514 9:97050070-97050092 GTGCCTGTAGGCCCAGCTATAGG No data
1057666512_1057666521 7 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666521 9:97050084-97050106 AGCTATAGGGAGGCTGAGGCAGG 0: 9
1: 149
2: 761
3: 2827
4: 7442
1057666512_1057666522 25 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666522 9:97050102-97050124 GCAGGAGAATTGCTTGAACCTGG 0: 30902
1: 81215
2: 152545
3: 104312
4: 56422
1057666512_1057666523 29 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666523 9:97050106-97050128 GAGAATTGCTTGAACCTGGCAGG 0: 270
1: 21982
2: 66339
3: 137901
4: 183904
1057666512_1057666518 3 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666518 9:97050080-97050102 GCCCAGCTATAGGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666512 Original CRISPR CAGGCACATGCCACTATGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr