ID: 1057666513

View in Genome Browser
Species Human (GRCh38)
Location 9:97050058-97050080
Sequence GCATAGTGGCATGTGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666508_1057666513 11 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data
1057666509_1057666513 10 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data
1057666506_1057666513 30 Left 1057666506 9:97050005-97050027 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data
1057666507_1057666513 25 Left 1057666507 9:97050010-97050032 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666513 Original CRISPR GCATAGTGGCATGTGCCTGT AGG Intergenic
No off target data available for this crispr