ID: 1057666517

View in Genome Browser
Species Human (GRCh38)
Location 9:97050074-97050096
Sequence CTGTAGGCCCAGCTATAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057666509_1057666517 26 Left 1057666509 9:97050025-97050047 CCTGTCTCTACTAAAAAAACAAA 0: 378
1: 174049
2: 223680
3: 151716
4: 111726
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data
1057666508_1057666517 27 Left 1057666508 9:97050024-97050046 CCCTGTCTCTACTAAAAAAACAA 0: 157
1: 67390
2: 170537
3: 207161
4: 162867
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data
1057666512_1057666517 -3 Left 1057666512 9:97050054-97050076 CCAGGCATAGTGGCATGTGCCTG 0: 134
1: 2731
2: 12574
3: 40765
4: 100148
Right 1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057666517 Original CRISPR CTGTAGGCCCAGCTATAGGG AGG Intergenic
No off target data available for this crispr