ID: 1057668619

View in Genome Browser
Species Human (GRCh38)
Location 9:97067736-97067758
Sequence TGCCGGAGCCACGGAAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 205}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057668607_1057668619 16 Left 1057668607 9:97067697-97067719 CCACTTCCCCTTGCCAGCGGGCT No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668611_1057668619 8 Left 1057668611 9:97067705-97067727 CCTTGCCAGCGGGCTAGGCACAG No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668603_1057668619 26 Left 1057668603 9:97067687-97067709 CCAGCTTCGCCCACTTCCCCTTG No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668609_1057668619 10 Left 1057668609 9:97067703-97067725 CCCCTTGCCAGCGGGCTAGGCAC No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668615_1057668619 3 Left 1057668615 9:97067710-97067732 CCAGCGGGCTAGGCACAGGGGAG No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668610_1057668619 9 Left 1057668610 9:97067704-97067726 CCCTTGCCAGCGGGCTAGGCACA No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205
1057668606_1057668619 17 Left 1057668606 9:97067696-97067718 CCCACTTCCCCTTGCCAGCGGGC No data
Right 1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG 0: 1
1: 1
2: 0
3: 11
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057668619 Original CRISPR TGCCGGAGCCACGGAAGATG AGG Intergenic
900466063 1:2826060-2826082 TGGGGGAGCCACAGAAGAGGGGG - Intergenic
903996077 1:27306323-27306345 TGCCGGGGCCTCTGATGATGAGG + Exonic
904222170 1:28980631-28980653 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
904521648 1:31100516-31100538 TGCTTGAGCCTCGGAAGTTGAGG + Intergenic
908465906 1:64394882-64394904 TGCAGGAGCCACAGTAGAAGAGG + Intergenic
908672166 1:66559866-66559888 TGCTGGAGCCAGGGAGGAGGGGG + Intronic
913271477 1:117097934-117097956 TTCTGTAGCCACGAAAGATGTGG - Intronic
915475347 1:156149862-156149884 TCCAGGAGCCACAGAAGGTGGGG + Intronic
915720289 1:157979416-157979438 TTCTGGAGTCAGGGAAGATGAGG + Intergenic
916309169 1:163375338-163375360 TGACTAAGCCAAGGAAGATGAGG - Intergenic
916674114 1:167052066-167052088 TGAGGGAGCCACGGAAGCAGAGG - Intergenic
920060232 1:203222327-203222349 TGCAGGAGGCATGGAAGAGGAGG + Intronic
921861659 1:220047682-220047704 CGCCTGAGCCCAGGAAGATGAGG + Intergenic
922447434 1:225709240-225709262 TGCCGGAGCTACTGGAGATGTGG - Intergenic
924187091 1:241504523-241504545 TGCCTGAGCCATGGAGGTTGAGG - Intronic
1063451424 10:6152795-6152817 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1064135954 10:12750965-12750987 TGCCGGAGCCCAGGAAGTGGAGG + Intronic
1068123925 10:52814605-52814627 TGCTGGAGCCAGGGAGGAAGGGG + Intergenic
1072425194 10:95324207-95324229 TGAGGGAGTCACTGAAGATGAGG - Intronic
1074577086 10:114680520-114680542 TGCCAGAGCCACAGAGGATTGGG - Intronic
1076613958 10:131744045-131744067 TGCAGGAGCCAGGGCAGCTGGGG + Intergenic
1078060379 11:8039291-8039313 TGCCGGAGCCCTGGAGGCTGGGG - Intronic
1079634928 11:22725510-22725532 TGCCTGAGCCCAGGAAGTTGAGG - Intronic
1080341366 11:31269464-31269486 TGCCTGAGCCTGGGAAGTTGAGG - Intronic
1081926316 11:46831946-46831968 TGCCAGAGCCCCGGAAGTCGAGG - Intronic
1084270997 11:68029135-68029157 AGCAGGAGCCAAGGAAGAGGAGG - Exonic
1084540786 11:69785558-69785580 TGCTTGAGCCAGGGAAGTTGAGG - Intergenic
1085468066 11:76737657-76737679 TGCCTGAGCCCAGGAAGTTGAGG - Intergenic
1089285836 11:117407567-117407589 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1091351718 11:134903212-134903234 TGAGGGAGCAAGGGAAGATGTGG + Intergenic
1091446517 12:546803-546825 TGCCGGACACACGGAAGCTCTGG - Intronic
1092876869 12:12856192-12856214 TGCTGGAGCCCCAGAATATGAGG - Intergenic
1093687231 12:22070687-22070709 TGCCACAGCCAGGGAAAATGGGG + Intronic
1094588192 12:31797100-31797122 TGCTTGAGCCCAGGAAGATGAGG - Intergenic
1096021610 12:48329894-48329916 TGCCAGAGCCAAGGAGGAAGCGG + Exonic
1096267965 12:50139397-50139419 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1096639143 12:52980340-52980362 AGCCAGAGCCTCGGAAGGTGAGG - Intergenic
1096727750 12:53578698-53578720 TGCTGGAGCCAGGGATGTTGAGG + Intronic
1099119306 12:78668106-78668128 TGCCTGAGCCTGGGAAGTTGAGG + Intergenic
1102182555 12:110923554-110923576 TGTTGCAGCCACAGAAGATGTGG + Intergenic
1105358129 13:19678838-19678860 TGCTTGAGCCTGGGAAGATGAGG - Intronic
1105731377 13:23220364-23220386 TGCCTGAGCCAGGGAGGAGGAGG + Intronic
1107890025 13:44905974-44905996 GGCAGGGGCCACGGAAGATGGGG + Intergenic
1108388908 13:49928356-49928378 TGTTGGAGCCAGGGAAGTTGAGG + Intronic
1110523298 13:76505957-76505979 TGCGGGAGAAACAGAAGATGAGG + Intergenic
1112315960 13:98362178-98362200 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1114308186 14:21442379-21442401 TGCCTGAGCCCGGGAAGTTGAGG + Intronic
1114483260 14:23048087-23048109 TGCCGGAGCCCAGGGAGCTGAGG + Exonic
1119636101 14:76274682-76274704 TCCCGGAGCCACAGAAACTGTGG + Intergenic
1120925347 14:89792399-89792421 TGACGGAGCTAAAGAAGATGGGG + Intergenic
1121491500 14:94364380-94364402 TGCCCGATCCAAAGAAGATGTGG - Intergenic
1122127391 14:99586718-99586740 TGTCTGAGCCACCGGAGATGTGG + Intronic
1122695942 14:103552172-103552194 GGCTGGAGCCTCTGAAGATGAGG - Intergenic
1122697374 14:103562657-103562679 TGCCGGAGCTGCGGAAGTCGTGG - Intronic
1124720597 15:32108185-32108207 TGCCAGAGCCATGGAAGAATTGG + Intronic
1126444438 15:48726766-48726788 GGCCAGAGCCAGGGTAGATGTGG - Intronic
1127346952 15:58110646-58110668 TGCTGGAGCCTGGGAAGTTGAGG - Intronic
1128791648 15:70438835-70438857 GGCCTGAGCCAGGGAAGCTGGGG - Intergenic
1129027843 15:72595560-72595582 TGCTGGAGCCAAGAAAGTTGAGG - Exonic
1129646876 15:77443787-77443809 TGCTGGAGCCCAGGAAGTTGAGG - Intronic
1132787034 16:1662780-1662802 TGCCAAAGCCCCGGAAGCTGCGG + Exonic
1132874459 16:2130174-2130196 TGCGGGAGCCACGTAAGACCCGG + Intronic
1132950275 16:2557890-2557912 CGCCGCAGCCTCGGAAGAAGCGG + Exonic
1132964071 16:2642280-2642302 CGCCGCAGCCTCGGAAGAAGCGG - Intergenic
1133119600 16:3597930-3597952 AGAAGGAGCCACGGAAGAGGCGG - Exonic
1134316206 16:13121073-13121095 TGCCTGAGCCCAGGAAGGTGAGG + Intronic
1134553404 16:15149007-15149029 TGCGGGAGCCACGTAAGACCCGG + Intergenic
1135575757 16:23584302-23584324 TGCCAGAGCTAGGGAGGATGGGG - Intronic
1136612689 16:31376891-31376913 GGGCGCCGCCACGGAAGATGAGG - Exonic
1136924450 16:34359041-34359063 TGCCTGAGCCTGGGAAGTTGAGG - Intergenic
1136980123 16:35052765-35052787 TGCCTGAGCCTGGGAAGTTGAGG + Intergenic
1137255978 16:46775897-46775919 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1137269360 16:46893474-46893496 TGCTGGAGCCACGGATGCGGAGG + Intronic
1139153963 16:64418535-64418557 TGCTGGAGCCCAGGAAGTTGAGG + Intergenic
1142332965 16:89467356-89467378 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1142712971 17:1733436-1733458 CTCGGGAGCCACAGAAGATGGGG - Intronic
1146213140 17:30957509-30957531 TGCCTGAGCCCAGGAAGAAGAGG - Intronic
1146371817 17:32269262-32269284 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1147450178 17:40499576-40499598 TACCGGAGCCACGGGCGTTGGGG - Intronic
1148053456 17:44780230-44780252 TGCTGGGGCCAGGGCAGATGTGG + Exonic
1148121569 17:45215513-45215535 TGCTTGAGCCAGGGAAGTTGAGG - Intergenic
1149141044 17:53434279-53434301 TGCTGGAGCCCTGGTAGATGGGG - Intergenic
1149443299 17:56693333-56693355 TGCCTGAGCCTGGGAAGTTGAGG - Intergenic
1149823263 17:59801327-59801349 TGCCAGAGCCCAGGAAGTTGAGG - Intronic
1149927112 17:60712290-60712312 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1150017440 17:61572668-61572690 TGCTGGAGCCTGGGAAGTTGAGG - Intergenic
1150823709 17:68457047-68457069 TGCGGGGGCCACGGAATATGGGG - Intronic
1152016609 17:77755159-77755181 TGAGGGAGCCACTGTAGATGTGG + Intergenic
1152231429 17:79115794-79115816 TCCCGGAGCCCCTGAGGATGGGG + Intronic
1152469473 17:80482848-80482870 TGCAGGGGCCAGGGTAGATGTGG + Intergenic
1152967103 18:126498-126520 TGCTGGAGCCCAGGAAGTTGAGG + Intergenic
1154926887 18:20945554-20945576 TGCTGGAGCCCAGGAAGTTGAGG - Intergenic
1156314992 18:35961356-35961378 TGCTTGAGCCAGGGAAGTTGAGG - Intergenic
1157833473 18:50878710-50878732 TGCCTGAGCCACAGAGGAAGGGG - Intergenic
1160782126 19:882438-882460 TGCTCGAGCCCAGGAAGATGAGG + Intronic
1160911089 19:1474114-1474136 TCCCGGGGCCCCGGAAGCTGGGG - Exonic
1161536247 19:4820504-4820526 TGCTTGAGCCAAGGAAGTTGAGG + Intronic
1162586575 19:11563015-11563037 TGCTGGAGCCTGGGAAGTTGAGG - Intronic
1165180506 19:33963507-33963529 TGCTGGAGCCCGGGAAGTTGAGG - Intergenic
1165431973 19:35778046-35778068 TGCAGGAGCCACAGCAGATGGGG + Intronic
1165441264 19:35829448-35829470 TGCCTGAGCCAGGGAAGTTGAGG - Intronic
1166560122 19:43727250-43727272 TGACGGAGGCCCGCAAGATGGGG + Intergenic
1167833029 19:52042463-52042485 TGCTGGAGCCCAGGAAGTTGAGG + Intronic
1168275011 19:55273071-55273093 TGCCTGAGCCTGGGAAGTTGAGG - Intronic
927472976 2:23389609-23389631 TGCTGGAGCCCAGGAAGTTGAGG + Intronic
927825482 2:26306674-26306696 TGCCCGAGCCAGGGAGGTTGAGG - Intergenic
928209010 2:29309926-29309948 TGCCTGAGTAACGTAAGATGAGG + Intronic
928212197 2:29331621-29331643 TGCTGGTCCCACGGAAGGTGTGG + Intronic
929186732 2:39102869-39102891 TGCTGGAGCCCAGGAAGTTGAGG + Intronic
930030569 2:47055979-47056001 AGCTGGAGCCAGGGAAGAGGAGG - Intronic
931353185 2:61510851-61510873 TGCTAGAGCCCCGGAAGTTGAGG + Intronic
931591995 2:63894617-63894639 TGCTTGAGCCACGGAGGTTGAGG + Intronic
933859128 2:86446893-86446915 TGCTTGAGCCAAGGAAGTTGAGG - Intronic
934086397 2:88513404-88513426 TGCCTGAGCCAGGGAGGTTGAGG + Intergenic
935292018 2:101619045-101619067 TGCTGGAGCCAGGGAAGTTGAGG - Intergenic
935842293 2:107126770-107126792 TCCCTGAGCCACAGAATATGGGG - Intergenic
938848011 2:135231702-135231724 TGCTGGAGCCTCGGAGGTTGAGG + Intronic
946261153 2:218492115-218492137 TGCTTGAGCCAGGGAAGTTGAGG + Intronic
1169828006 20:9790914-9790936 TGGAGAGGCCACGGAAGATGAGG - Intronic
1170017923 20:11802933-11802955 TGTTAGAGCCAGGGAAGATGTGG - Intergenic
1172109635 20:32537334-32537356 CCCCGGAGCCACAGCAGATGTGG - Intronic
1172239493 20:33402944-33402966 TGCTTGAGCCAGGGAAGTTGAGG + Intergenic
1173183256 20:40820446-40820468 TGCCTGAGTCAGGGAAGACGGGG - Intergenic
1173330435 20:42071738-42071760 TGCCTGAGCCTAGGAAGTTGAGG - Intergenic
1173881819 20:46420195-46420217 TGCTGGAGCCTGGGAAGTTGAGG - Intronic
1173987744 20:47275684-47275706 TGCCGGAGCCTGGGAGGTTGAGG - Intronic
1174312515 20:49668943-49668965 TGCTTGAGCCAAGGAAGTTGAGG - Intronic
1174406121 20:50304520-50304542 TGGCAGAGCCACGGGGGATGGGG + Intergenic
1178077049 21:29022025-29022047 TGCCTGAGCCTGGGAAGTTGAGG + Intergenic
1178943475 21:36926824-36926846 TGCCTGAGCCAGGGAGGTTGAGG - Intronic
1179819547 21:43928901-43928923 TGCCGGAGCCACCTAGGGTGGGG - Intronic
1181003412 22:19998448-19998470 TTTCGGAGCCAAGGAAGCTGAGG + Intronic
1181411600 22:22725879-22725901 TGCTGGAGCCAGAGAAGTTGAGG + Intergenic
1181585713 22:23852486-23852508 TACCTGAGCCAGGGAAGTTGAGG - Intergenic
1182284337 22:29235871-29235893 TGCCTGAGCCAGGGAGGTTGGGG - Intronic
1182691236 22:32165008-32165030 TACTGGAGCCAGGGAAGTTGAGG - Intergenic
1183651118 22:39153548-39153570 TGCCGGAGCGACAGAAGTTGGGG - Intergenic
1184227652 22:43138651-43138673 TGCTGGAGCCCAGGAAGTTGAGG + Intronic
953391195 3:42534877-42534899 AGCTGGAGGCACAGAAGATGGGG - Intronic
954000163 3:47550209-47550231 TGCTTGAGCCACGGAGGTTGAGG - Intergenic
954026479 3:47787083-47787105 TGCCTGAGCCCTGGAAGTTGAGG + Intergenic
955206862 3:56903945-56903967 TGCCTGAGCCAAGGAGGTTGAGG - Intronic
956582032 3:70824576-70824598 TGCAGGAGGCAAGGAAGTTGGGG - Intergenic
956715335 3:72074902-72074924 TGCCTGAGCCAGGGAGGTTGAGG - Intergenic
958450683 3:94268679-94268701 TGTCGGAGACATGGAAGGTGGGG - Intergenic
960048339 3:113218241-113218263 TGGCAGAGCCAGGGAAGGTGGGG - Intronic
961025348 3:123550795-123550817 TGTGGGAGCCACTGAAGCTGTGG + Intronic
963267646 3:143254954-143254976 TGCAGGAGCCACGGATGAAAGGG + Intergenic
966139698 3:176741784-176741806 TGCCATTGCCAAGGAAGATGTGG - Intergenic
966884077 3:184365585-184365607 TGCCTGAGCCAGGGAGGTTGAGG + Intronic
970606572 4:17687131-17687153 GGCCTGAGCCCTGGAAGATGGGG + Intronic
971394659 4:26216839-26216861 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
972897811 4:43644756-43644778 GGCTGGAGCCAGCGAAGATGTGG + Intergenic
979626728 4:122853212-122853234 TGCTGGAGCCAGGGAAGTTGAGG + Intronic
982137824 4:152288840-152288862 TGCTGGAGCCACGGCAGCAGTGG + Intergenic
984733453 4:183089325-183089347 TGTCAGAGCCCCAGAAGATGAGG + Intergenic
985691113 5:1313120-1313142 TGCCGTGGCCACGGACGGTGAGG - Intergenic
985707087 5:1407638-1407660 CTCCGGAACCACGGGAGATGGGG - Intronic
991422775 5:66458142-66458164 TGCTGGAGCCCAGGAAGTTGAGG - Intergenic
991985706 5:72284338-72284360 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
992032846 5:72740560-72740582 TGCCGGAGCCTCGGGGGAGGAGG - Intergenic
993098578 5:83508930-83508952 TGCTGGAGGCAAGGAAGTTGAGG + Intronic
998757773 5:145399646-145399668 TGCAGGAGCCCTGGGAGATGAGG - Intergenic
999006577 5:147986770-147986792 TGCCAGAGCCAAGGAGGTTGAGG - Intergenic
1000397987 5:160796246-160796268 TGATGGAGACAAGGAAGATGTGG - Intronic
1001433360 5:171680765-171680787 TCCTGGAGCCACAGAACATGTGG - Intergenic
1002025111 5:176391526-176391548 TGCCTGACCCAAGGAAGTTGAGG + Intronic
1003253856 6:4457402-4457424 TGCCAGAGCCACAGAGGATGAGG + Intergenic
1003870446 6:10398569-10398591 TGCCGAAGCCGTGGGAGATGAGG + Exonic
1004013853 6:11714484-11714506 TGAGGCAGCCACGGAAGAAGAGG - Exonic
1004151658 6:13125844-13125866 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1004714508 6:18204388-18204410 TGCTGGAGCCCCGGAAGTTGAGG + Intronic
1004723144 6:18285984-18286006 TGCTTGAGCCAGGGAAGTTGAGG + Intergenic
1007814898 6:44514799-44514821 GGCGGGAGCCAGGGAAGGTGAGG + Intergenic
1010439860 6:75881168-75881190 TGCCTGAGCCTGGGAAGTTGAGG + Intronic
1013188263 6:107780621-107780643 TGCCTGAGCCCGGGAAGTTGAGG + Intronic
1013229390 6:108148275-108148297 TGCTGGAGCCTGGGAAGTTGAGG - Intronic
1013464404 6:110405118-110405140 TGCCTGAGCCCCAGAAGTTGAGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017976131 6:159359000-159359022 TGGCTGAGCCACGGAAGGTTGGG - Intergenic
1020007427 7:4790002-4790024 TGCCGAAGCCACTGAAGGGGAGG - Intronic
1020083534 7:5298714-5298736 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1020419385 7:7984142-7984164 TGCTGGAGCCCAGGAAGCTGAGG - Intronic
1023601657 7:41886938-41886960 AGCCGGAGCCAGGGAAAATGGGG - Intergenic
1024832140 7:53473395-53473417 TGCCAGAGGCACAGAAGAGGTGG + Intergenic
1025012180 7:55406369-55406391 TGTTGAAGCCACAGAAGATGGGG + Intronic
1025982209 7:66415818-66415840 TGCCTGAGCCCCGGAGGTTGAGG - Intronic
1026249329 7:68654396-68654418 TGCTTGAGCCTGGGAAGATGAGG + Intergenic
1027272757 7:76532770-76532792 CACCGGACCCACGGGAGATGTGG - Intergenic
1032855520 7:135830396-135830418 TGCCGAAGCCCAGGAAGGTGTGG + Intergenic
1033180219 7:139169928-139169950 TGCCTGAGCCCAGGAAGTTGAGG + Intronic
1033350623 7:140559109-140559131 TGAGGGAGCAGCGGAAGATGGGG + Intronic
1038331820 8:26615055-26615077 TGCCAGAGGCACGGGAGGTGTGG + Intronic
1038504515 8:28073084-28073106 TGCTTGAGCCACGGAGGTTGAGG - Intronic
1041233637 8:55777089-55777111 TGCTTGAGCCAGGGAAGTTGAGG - Intronic
1041429722 8:57765794-57765816 TGCCCGTGCCAGGGAAGAGGCGG + Intergenic
1042904521 8:73759255-73759277 TGCTGGAGCCCGGGAAGTTGAGG + Intronic
1045838618 8:106553400-106553422 TGCTTGAGCCAGGGAAGTTGAGG - Intronic
1047406640 8:124590822-124590844 TGCGGGAGCCTCGCAAGAAGAGG - Intronic
1047972697 8:130099092-130099114 TTCCAGAGCCCCGGAAGTTGAGG - Intronic
1047984762 8:130221148-130221170 TGCTGGAGCCTGGGAAGTTGAGG + Intronic
1049197884 8:141325479-141325501 TGTCGGGGCCACGGCAGGTGGGG - Intergenic
1051652639 9:19344576-19344598 TGCCTGAGCCCAGGAAGTTGAGG - Intronic
1052815940 9:33102647-33102669 TGCCCCAGCCAGGGAAGCTGTGG - Intergenic
1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG + Intergenic
1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG + Intergenic
1057671665 9:97095873-97095895 TGCTTGAGCCCAGGAAGATGAGG + Intergenic
1058488885 9:105473220-105473242 TGCCTGAGCCTAGGAAGTTGAGG + Intronic
1060098069 9:120811716-120811738 TGCTGGAGCCCTGGAAGTTGAGG - Intergenic
1060602586 9:124888085-124888107 TGCAGGAGGAACGGAAGATCAGG + Intronic
1060932581 9:127498111-127498133 AGCCAGAGCCAAGGAAGAAGCGG + Intronic
1060943534 9:127556991-127557013 TGCCGGAGCCCGGGAGGTTGAGG + Intronic
1061061175 9:128251074-128251096 TGCCGGAGCCACGCCACGTGTGG + Intronic
1061909526 9:133715404-133715426 TGCCAGACCCACGCAAGCTGCGG + Intronic
1192121812 X:68463656-68463678 TGCCTGAGCCCAGGAAGTTGAGG - Intergenic
1196411827 X:115427810-115427832 TGCCTGAGCCCGGGAAGTTGAGG + Intergenic
1196780590 X:119380459-119380481 TGCTGGAGCCAGGGAAGTCGAGG - Intergenic
1199454654 X:148014726-148014748 TGCCGGAGCCCGGGAAGTCGAGG - Intronic