ID: 1057672739

View in Genome Browser
Species Human (GRCh38)
Location 9:97108886-97108908
Sequence ACATGATGGTAGGTGTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057672739_1057672743 11 Left 1057672739 9:97108886-97108908 CCACTATACACCTACCATCATGT No data
Right 1057672743 9:97108920-97108942 AAGGCCTAAAGTACTGAGTTTGG No data
1057672739_1057672745 22 Left 1057672739 9:97108886-97108908 CCACTATACACCTACCATCATGT No data
Right 1057672745 9:97108931-97108953 TACTGAGTTTGGCAAGAATTTGG No data
1057672739_1057672742 -8 Left 1057672739 9:97108886-97108908 CCACTATACACCTACCATCATGT No data
Right 1057672742 9:97108901-97108923 CATCATGTCTAAAATTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057672739 Original CRISPR ACATGATGGTAGGTGTATAG TGG (reversed) Intergenic
No off target data available for this crispr