ID: 1057673731

View in Genome Browser
Species Human (GRCh38)
Location 9:97120161-97120183
Sequence ATTGATCAAAAGATGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057673729_1057673731 22 Left 1057673729 9:97120116-97120138 CCATAATACATCAATTATTACAC No data
Right 1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057673731 Original CRISPR ATTGATCAAAAGATGGAGAT TGG Intergenic
No off target data available for this crispr