ID: 1057680236

View in Genome Browser
Species Human (GRCh38)
Location 9:97174423-97174445
Sequence TATGTGTACTAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057680236_1057680242 22 Left 1057680236 9:97174423-97174445 CCCTCTTCCCTCTAGTACACATA No data
Right 1057680242 9:97174468-97174490 CACACTCATACATTGCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057680236 Original CRISPR TATGTGTACTAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr