ID: 1057680471

View in Genome Browser
Species Human (GRCh38)
Location 9:97177023-97177045
Sequence AAGGACAGCATGGGTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 2, 1: 1, 2: 8, 3: 55, 4: 494}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057680464_1057680471 25 Left 1057680464 9:97176975-97176997 CCAGGTCTGAATGAATGAGGCTA 0: 11
1: 1
2: 12
3: 12
4: 100
Right 1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG 0: 2
1: 1
2: 8
3: 55
4: 494
1057680462_1057680471 29 Left 1057680462 9:97176971-97176993 CCTGCCAGGTCTGAATGAATGAG No data
Right 1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG 0: 2
1: 1
2: 8
3: 55
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057680471 Original CRISPR AAGGACAGCATGGGTAAAAC TGG Intergenic
900814595 1:4833786-4833808 GAGAACAGCATGAGAAAAACTGG + Intergenic
901365195 1:8741500-8741522 GAGAACAGCATGGGAGAAACCGG - Intronic
901378350 1:8855787-8855809 AAGAACAGCATGGGGGAAACCGG - Intergenic
902634773 1:17728121-17728143 AAGAATAGCATGGGAAAGACTGG + Intergenic
902962561 1:19975241-19975263 AAGGCCAGCCTGGGCAACACAGG - Intergenic
903016989 1:20367550-20367572 GGGCACAGCATGGGTGAAACAGG - Intergenic
904303783 1:29573827-29573849 AAGGAGAGCCTGGGCAAGACAGG - Intergenic
904386300 1:30144578-30144600 AAGAATAGCATGGGAAAGACTGG + Intergenic
904683218 1:32242975-32242997 AAGACCAGCCTGGGCAAAACAGG - Intergenic
904880679 1:33694461-33694483 GAGAACAGTATGGGGAAAACTGG - Intronic
905154834 1:35967841-35967863 AAGGGCATCATTGGAAAAACTGG - Intronic
905913304 1:41668584-41668606 AGGAACAGCATGGGGAAAAGTGG - Intronic
905948892 1:41928550-41928572 AAGGACATCAGTGGAAAAACTGG - Intronic
906793526 1:48678761-48678783 AAGGACACCATGGGGAACTCAGG - Intronic
907392397 1:54166830-54166852 GAGAACAGCATGGGAAAGACTGG + Intronic
907412885 1:54294841-54294863 AAGGACAGCAGAGGAAAAAGGGG + Intronic
907784369 1:57597343-57597365 AAGGACAGCAAGAGTCAACCAGG + Intronic
907925806 1:58954126-58954148 AAGTATAGCATGGGAAAGACCGG - Intergenic
907984318 1:59515631-59515653 GAGAACAGCATGGGAAAGACTGG - Intronic
908624925 1:66029262-66029284 GAGGGTAGCATGGGTAAGACCGG + Intronic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
909762246 1:79304974-79304996 TAAGACATCATAGGTAAAACAGG + Intergenic
911521156 1:98932240-98932262 AAGTACAACATGGGTTAAATAGG + Intronic
915308084 1:154992646-154992668 CAGGACAGCAGGGGTAGAAGTGG + Intronic
915546723 1:156603244-156603266 AAGGCCAGCCTGGGAAACACAGG - Intergenic
915974982 1:160379507-160379529 AAGAAAAGCATTGGTAGAACTGG - Intergenic
916171699 1:162005935-162005957 CAGGACAGCAGGAGTAAACCAGG + Intronic
916251512 1:162742921-162742943 AAGGATAGCACGGGAAAGACGGG + Intronic
916294195 1:163198867-163198889 AAGGGCAGCCTGGGCAACACAGG - Intronic
916482261 1:165225150-165225172 AAGGACAGCTTGGGGGAAAGAGG + Intronic
917576085 1:176323126-176323148 TAGGATAGGAGGGGTAAAACAGG - Intergenic
917970839 1:180206444-180206466 AAGAACAGCCTGGGCAACACAGG - Intergenic
918786922 1:188775106-188775128 AAGAATAGCATGGGAAAGACTGG - Intergenic
919273603 1:195384031-195384053 GAGAACAGCATGGGGGAAACTGG - Intergenic
920443222 1:205995580-205995602 TATGACAACATGGGTAAACCTGG + Intronic
922414744 1:225410831-225410853 AAGGACAACAGCGGAAAAACTGG + Intronic
922426319 1:225498947-225498969 TTGGACAGCATGGGTCAACCAGG - Intronic
923839961 1:237659469-237659491 GATGAAAGAATGGGTAAAACAGG + Intronic
1063161893 10:3424384-3424406 AAAGACAGCTTGGGTGAACCTGG - Intergenic
1064032181 10:11889850-11889872 AAGGACATCATGGAGAAGACTGG + Intergenic
1064389384 10:14928500-14928522 AAGGACACTATGGGAAGAACTGG + Intronic
1064832747 10:19489265-19489287 AAGGAGAGCAAAGGGAAAACAGG + Intronic
1065003761 10:21361258-21361280 GAGAACAGCATGGGGAAAACCGG + Intergenic
1065347882 10:24766078-24766100 AAGAATAGCATGGGAAAGACTGG + Intergenic
1066412541 10:35187702-35187724 AAGGCCAGCCTGGGCAACACAGG - Intronic
1067142742 10:43670233-43670255 AAGAACAGCCTGGGTAACACAGG - Intergenic
1067466082 10:46500233-46500255 AAGGAATGCATGGTCAAAACAGG - Intergenic
1067621106 10:47884373-47884395 AAGGAATGCATGGTCAAAACAGG + Intergenic
1067837226 10:49649065-49649087 TAGGAGAGAATGGGTAAAATTGG - Intronic
1067845216 10:49714625-49714647 AAGAACATCAAGGGTAAAAAAGG + Intergenic
1068028992 10:51684505-51684527 AAAGACACCATGGGAAAAATAGG + Intronic
1068354543 10:55894576-55894598 AAGAATAGCATGGGAAAGACAGG - Intergenic
1068439560 10:57033177-57033199 AAGAATAGCATGGGAAAGACAGG - Intergenic
1068519614 10:58063932-58063954 AAGAATAGCATGGGAAAGACTGG + Intergenic
1068676983 10:59778745-59778767 GAGGATAGCATGGGAAAGACTGG + Intergenic
1068903834 10:62300405-62300427 CAGGACAGCAAGTGTAAACCAGG - Intergenic
1070606841 10:77904572-77904594 AAGAATAGCATGGGAAAGACCGG - Intronic
1070885180 10:79888946-79888968 ATGGGCAGGATGGGTAAAATAGG - Intergenic
1071306713 10:84305609-84305631 GAGTACAGCATGGGAGAAACTGG - Intergenic
1071419772 10:85480928-85480950 AAGGACATTATGGGGAAAATGGG + Intergenic
1072702422 10:97652498-97652520 AAGACCAGCCTGGGCAAAACAGG - Intronic
1073003983 10:100307457-100307479 TAGAGCAGCATGGGCAAAACTGG + Intronic
1073274036 10:102292566-102292588 AAGGCCAGCCTGGGCAGAACTGG - Intronic
1074025115 10:109626381-109626403 GAGAACAGCATGGGAAAAACTGG + Intergenic
1074367987 10:112875449-112875471 AAGGACAGTAGTGGGAAAACTGG - Intergenic
1075235628 10:120725069-120725091 CAAGACAGCACGGGAAAAACTGG - Intergenic
1076261778 10:129072152-129072174 GAGAACAGCATGGGAAAGACAGG - Intergenic
1076430321 10:130397457-130397479 AAGTATAGCACGGGAAAAACCGG - Intergenic
1077738618 11:4819777-4819799 AAGACCAGCATGGGTAACATAGG - Intronic
1077997393 11:7465900-7465922 AAGAACAGCACGGGGAAGACCGG + Intronic
1078128876 11:8595079-8595101 AAGACCAGCCTGGGTAACACTGG + Intergenic
1079160317 11:17986355-17986377 AAGGCCAGAATGGTTAAACCTGG - Intronic
1079341202 11:19613107-19613129 AAGAAGAGCATGGGAAAGACCGG + Intronic
1079701425 11:23553338-23553360 AAGAATAGCATGGGAAAGACTGG + Intergenic
1080067932 11:28041729-28041751 AATGACAGCTTGGGTAAGAGTGG + Intronic
1080477310 11:32608001-32608023 AAGAACAGCATAGGAAAGACCGG + Intronic
1080829909 11:35883148-35883170 TATGACACCATGGGTAAATCTGG - Intergenic
1080984729 11:37448075-37448097 AAGAACATCTTGGGTAATACAGG - Intergenic
1081008015 11:37773192-37773214 AATAACAGCATGGGAAAGACTGG + Intergenic
1084721990 11:70912426-70912448 AAGAATAGCATGGGAAAGACCGG - Intronic
1084898209 11:72291234-72291256 AAGGACATCATCGGGAAAACTGG + Intergenic
1085183506 11:74556290-74556312 AAGACCAGCCTGGGTAACACAGG + Intronic
1085740756 11:79076520-79076542 GAGAACAGCATGGGAAAAACCGG + Intronic
1086276725 11:85138648-85138670 AAGTATAGCATGGGAAAGACCGG - Intronic
1086488804 11:87337650-87337672 AAGGACAGCTTGACTAAAAAAGG + Intergenic
1086973702 11:93109918-93109940 AAAGAAAGAATGGGTAAAAAGGG + Intergenic
1087123434 11:94598905-94598927 AAGGCCAGCCTGGGCAACACAGG - Intronic
1087422591 11:97949143-97949165 AAGTAGAGTATGGTTAAAACTGG - Intergenic
1087536569 11:99454389-99454411 GAGAACAGCATGGGGAAAACTGG - Intronic
1087541765 11:99530697-99530719 AAGAATAGCATGGGAAAGACTGG - Intronic
1087603009 11:100339559-100339581 AAGGAGAGAATGGGCAAAAAAGG + Intronic
1087747581 11:101967214-101967236 AAGACCAGCCTGGGTAACACAGG - Intronic
1088304671 11:108395289-108395311 AAGACCAGCCTGGGTAAAATAGG + Intronic
1088327282 11:108613922-108613944 AAGAACAGCCTGGGCAACACAGG + Intergenic
1088688049 11:112301250-112301272 AAGGACAGTATTGGGAAAACTGG - Intergenic
1091505171 12:1060653-1060675 AAGAATAGCATGGGAAAGACTGG + Intronic
1092338768 12:7657671-7657693 AAGGCCAGCCTGGGTAAAATGGG + Intronic
1093962750 12:25293066-25293088 AAGAATAGCATAGGAAAAACCGG - Intergenic
1095628388 12:44344799-44344821 AATGACAGCATGAGTAGAAAAGG - Intronic
1095968925 12:47888202-47888224 GAGAATAGCATGGGAAAAACTGG + Intronic
1096151294 12:49314744-49314766 AAGGACATCACTGGGAAAACTGG + Intergenic
1096419005 12:51440102-51440124 AAGGACAGCGTGTGGTAAACAGG + Intronic
1098078397 12:66758340-66758362 AAGAATAGCATGGGAAAGACTGG + Intronic
1098186942 12:67906689-67906711 AGCGACAACATGGGTGAAACTGG - Intergenic
1098837577 12:75440948-75440970 AAGAATAGCATGGGAAAGACTGG - Intergenic
1099168603 12:79337463-79337485 GAGGACATCATGGGGAAAATGGG - Intronic
1099494514 12:83329653-83329675 AAGGACAGCATAGGTAAGTAGGG - Intergenic
1099700206 12:86074051-86074073 GAGCACAGCATGAGAAAAACTGG - Intronic
1099707997 12:86181053-86181075 GAGAATAGCATGGGAAAAACTGG - Intronic
1100059854 12:90561372-90561394 AAAGACAGCAGGGGAAAAAAAGG - Intergenic
1100133791 12:91528764-91528786 GAGAACAGCATGGGGGAAACTGG - Intergenic
1100598325 12:96090501-96090523 GAGAACAGCATGGGAAAGACTGG - Intergenic
1100849001 12:98689658-98689680 AAGACCAGCCTGGGTAACACAGG - Intronic
1100851159 12:98713016-98713038 AAGGCCAGCCTGGGCAACACTGG - Intronic
1101542035 12:105674095-105674117 AAGGACATCAATGGAAAAACTGG - Intergenic
1102280560 12:111615465-111615487 AAGACCAGCCTGGGTAACACAGG - Intergenic
1102399619 12:112617143-112617165 AAGGAAAGCAGGGGACAAACCGG - Intronic
1102447918 12:113017863-113017885 GAGAACAGCATGGGAAAAACCGG + Intergenic
1102994266 12:117336252-117336274 ATGGAAAGCACGGGTAAACCAGG - Intronic
1103264386 12:119616773-119616795 AAGAACAGCATGGGAGAAACTGG - Intronic
1103593371 12:122007947-122007969 AAGGACATCAGTGGAAAAACTGG + Intergenic
1103902041 12:124308442-124308464 AAGGGCAGTGTGGGTAGAACAGG - Intronic
1104290203 12:127459742-127459764 AAGGACAGAATTGTTTAAACTGG - Intergenic
1105361846 13:19725953-19725975 AAGACCAGCCTGGGTAACACAGG + Intronic
1106177666 13:27345052-27345074 AAGAACAGCATGGGGGAAATCGG + Intergenic
1107282263 13:38750275-38750297 AAGAACAGCAAGGGAAAGACCGG - Intronic
1107698674 13:43024855-43024877 GAGGACAGCCTGGGCAACACAGG + Intronic
1108471848 13:50774985-50775007 TAGGAAAGCATGGGTATAATGGG - Intronic
1108724189 13:53162913-53162935 AAGAATAGCATGGGAAAGACTGG + Intergenic
1109454133 13:62561245-62561267 AATGACAACATGGGTGAAACTGG + Intergenic
1109771937 13:66986232-66986254 AAGAACAGCATGGGAGTAACTGG + Intronic
1110015433 13:70394375-70394397 AAGAACAGCATGGATCAAGCAGG + Intergenic
1110488887 13:76079348-76079370 AAGAATAGCATGGGAAAGACCGG - Intergenic
1111428042 13:88115367-88115389 CAGTAAAGCATGGATAAAACTGG + Intergenic
1112468222 13:99663797-99663819 CAGGAGAGCAGGAGTAAAACGGG - Intronic
1114826434 14:26086356-26086378 GAGAACAGCATGGGGGAAACCGG + Intergenic
1115259118 14:31435212-31435234 AAGAACAGCCTGGGCAACACAGG - Intronic
1115663343 14:35519259-35519281 AAAAACAGCCTGGGTAAAATAGG - Intergenic
1116095005 14:40356546-40356568 AAGAACAGCTTGGGCAATACAGG - Intergenic
1116167973 14:41358380-41358402 AAGAATAGCATGGGAAAGACTGG - Intergenic
1117163779 14:53014414-53014436 AGGGAAAGCATGGGTAAACTAGG + Intergenic
1117735083 14:58761065-58761087 AATGTCAGTATGGGTAAAAAAGG - Intergenic
1117756546 14:58980110-58980132 AAGGCCTGCATGAGTGAAACAGG + Intergenic
1119358896 14:74031310-74031332 AAGATCAGCCTGGGTAACACAGG - Intronic
1120017863 14:79494834-79494856 AAGGACAGTAGTGGAAAAACTGG - Intronic
1120104803 14:80481348-80481370 AAGAACAGCATGGGAAAGACCGG + Intronic
1120518588 14:85499665-85499687 AAGAACACTATGGGGAAAACTGG + Intergenic
1120614721 14:86689004-86689026 ATGGACAGCAAGGCTAAAAAAGG + Intergenic
1121611379 14:95283152-95283174 AAGAATAGCATGGGAAATACAGG - Intronic
1122377947 14:101279200-101279222 AAGGACAGTATGGGGGAAAGTGG + Intergenic
1124691667 15:31828618-31828640 AAGGACAGTATGGAGAAAACGGG + Intronic
1125174403 15:36804429-36804451 AAGGACAAGATGGGCAATACAGG - Intronic
1127331891 15:57947927-57947949 AAGGACAGCAGAGAGAAAACTGG - Intergenic
1127397221 15:58552507-58552529 AAGGGCAGCACGGGGAAGACAGG - Intronic
1127720639 15:61695409-61695431 AAGAATAGCATGGGAAAGACTGG - Intergenic
1127902283 15:63349754-63349776 AAGGACAGCGTGGGGAAGCCAGG - Intronic
1129594928 15:76955420-76955442 AAGACCAGCCTGGGTAACACAGG + Intergenic
1130283147 15:82534323-82534345 ACGGCCAGCCTGGGTAACACAGG + Intergenic
1131013409 15:89038262-89038284 CAGGACAGCCTGGGTGAAGCAGG - Intergenic
1131099223 15:89674898-89674920 AAGGCCAGCCTGGGCAACACAGG + Intronic
1131980041 15:97986083-97986105 GAGAACAACATGGGAAAAACTGG - Intergenic
1132010803 15:98274682-98274704 AATGACATCATGGTTAAGACTGG - Intergenic
1132045681 15:98561132-98561154 AAGACCAGCCTGGGTAACACAGG - Intergenic
1133808539 16:9144009-9144031 AAGACCAGCCTGGGTAACACAGG - Intergenic
1134331838 16:13258776-13258798 GAGAATAGCATGGGAAAAACTGG + Intergenic
1134541822 16:15073257-15073279 AAGGGCAGCCTGGGGAACACAGG + Intronic
1135054680 16:19220990-19221012 AAGACCAGCCTGGGTAACACAGG + Intronic
1135578870 16:23608252-23608274 AACAACAGCCTGGGTAACACAGG - Intronic
1135958959 16:26979876-26979898 AAGGACAGCAAGGATAGGACAGG + Intergenic
1136164349 16:28442929-28442951 AAGATCAGCATGGTTAACACAGG + Intergenic
1136198617 16:28672051-28672073 AAGATCAGCATGGTTAACACAGG - Intergenic
1136214963 16:28786228-28786250 AAGATCAGCATGGTTAACACAGG - Intergenic
1136259686 16:29066073-29066095 AAGATCAGCATGGTTAACACAGG - Intergenic
1137326817 16:47447065-47447087 AAGACCAGCCTGGGTAACACAGG - Intronic
1137879234 16:52029509-52029531 AAGTACAGAATGGGGAAAAGGGG + Intronic
1138024621 16:53512746-53512768 AAGAACAGCATGGGAAAGACCGG + Intergenic
1139102188 16:63781621-63781643 GAGAACAGCATGGGGGAAACTGG - Intergenic
1140243765 16:73229632-73229654 AAGGGCAGCATGGTTCAAAAGGG + Intergenic
1141645182 16:85363667-85363689 AGGCACAGCATGGGAAAATCAGG - Intergenic
1142682230 17:1556964-1556986 AAAGACAGCATGGCCAAAGCAGG + Intronic
1143005830 17:3833050-3833072 GAGGCCAGCCTGGGTAACACAGG + Intronic
1144357286 17:14458342-14458364 GAGGACCGCAAGGGAAAAACAGG - Intergenic
1145378038 17:22370127-22370149 AAGAATAGCATGGGAAAGACTGG + Intergenic
1145877677 17:28331957-28331979 AAGGACATCCTGGGTGAAGCAGG - Exonic
1146320144 17:31840560-31840582 GAGGAGAGCATGGGAAAAACAGG + Intergenic
1146988332 17:37243564-37243586 AAAGAAAGCATTGGTAAAATAGG + Intronic
1147624186 17:41888684-41888706 AAGGCCAGCCTGGGCAACACAGG + Intronic
1147697638 17:42368135-42368157 AAGGCCAGCCTGGGTAACATAGG + Intronic
1147964207 17:44185109-44185131 AAGGCCAGCCTGGGCAACACAGG - Intergenic
1148040733 17:44704790-44704812 AAGGTCAGCCTGGGCAAAATAGG - Intergenic
1148229475 17:45922609-45922631 AAGGAGAGGATGCCTAAAACAGG + Intronic
1148826027 17:50394980-50395002 AAGGGCAGCCTAGGTAAAAGAGG + Exonic
1149064807 17:52466597-52466619 GAGAATAGCATGGGAAAAACTGG - Intergenic
1149815950 17:59724010-59724032 AAGACCAGCATGGGCAAAATGGG + Intronic
1149980576 17:61308132-61308154 AACAACAGCATGGGCACAACTGG + Intronic
1152483758 17:80575202-80575224 AAGACCAGCCTGGGTAACACAGG - Intronic
1152641580 17:81451631-81451653 AAGGTCAGCATGGGCATAACTGG - Intronic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1155128021 18:22900136-22900158 CAGGACAGCCTGGATAATACAGG + Intronic
1156217261 18:35012177-35012199 AAGCACAACATGGGCAATACTGG - Intronic
1157015410 18:43706574-43706596 AATGACAGCATGAGAAAGACTGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157280973 18:46346101-46346123 GAGGACAGCTTGGGTTTAACTGG + Intronic
1157362469 18:47032445-47032467 AAGAACAGCCTGGGCAAAATAGG - Intronic
1157950841 18:52035172-52035194 GAGAACAGCATGGGAAATACCGG - Intergenic
1158141137 18:54257421-54257443 AAGGACATTAGGGGAAAAACTGG - Intergenic
1160282586 18:77506349-77506371 GAGAACAGTATGGGAAAAACGGG + Intergenic
1160430486 18:78808416-78808438 AAGGAAAGCATGGGTTGAGCTGG + Intergenic
1162296434 19:9817019-9817041 AAGAATAGCATGGGAAAGACTGG + Intronic
1162548192 19:11343581-11343603 AAGGACAGCCTGGGCAACATGGG + Intronic
1162834840 19:13309491-13309513 AAGACCAGCCTGGGTAACACAGG + Intronic
1164438342 19:28251769-28251791 AAGGAAAGAAGGGGTAAAGCTGG - Intergenic
1164537210 19:29094769-29094791 AGGGACAGCATGAGTGAAGCGGG - Intergenic
1164604777 19:29589912-29589934 AAGAATAGCATGGGGGAAACCGG + Intergenic
1164736150 19:30543009-30543031 AAGACCAGCATGGGCAACACAGG - Intronic
1165697874 19:37914702-37914724 AAGATCAGCCTGGGCAAAACAGG - Intronic
1166440953 19:42814951-42814973 AAGGCCAGCATGGGAAACATAGG - Intronic
1166460427 19:42983557-42983579 AAGGCCAGCATGGGAAACATAGG - Intronic
1166770247 19:45277596-45277618 AAGAACAGCCTGGGCAACACAGG - Intronic
1166871859 19:45876149-45876171 AAGAATAGCATGGGCAACACAGG - Intergenic
1167750019 19:51373694-51373716 AAGAACAGCATGGGGGAAGCCGG - Intergenic
925418791 2:3693626-3693648 TAGCACAGCATGGGGAACACAGG + Intronic
925775377 2:7330147-7330169 AAGAATAGCATGGGAAAGACCGG - Intergenic
926022602 2:9510317-9510339 GAGGCCAGCCTGGGTAACACAGG + Intronic
926959458 2:18338189-18338211 GAGGACAGTTTGGGTAAAATAGG + Intronic
927082864 2:19647775-19647797 AAAGACAGAATGGGAAAAGCAGG + Intergenic
927095427 2:19744637-19744659 CAGGTCAGCCTGGGGAAAACAGG + Intergenic
928062773 2:28131755-28131777 AAGGAGAGGATGGGTAAATAAGG + Intronic
928982102 2:37146651-37146673 TAGGACACCATGGGCAAAGCTGG - Intronic
929134456 2:38609723-38609745 GAGAACAGCACGGGGAAAACTGG + Intergenic
929356533 2:41031198-41031220 GAGGACAGCATGGGAAAGACTGG + Intergenic
929748129 2:44680597-44680619 ATGAACAGCATGGGCATAACTGG - Intronic
930006921 2:46904979-46905001 AAGAATAGCATGGGAAAGACTGG - Exonic
930090686 2:47529211-47529233 CAGGACAGCATGTATAAACCAGG + Intronic
930900943 2:56507097-56507119 AAGATCAGCCTGGGTAACACAGG + Intergenic
931120692 2:59215871-59215893 AAGAACAGCATTGGGGAAACCGG + Intergenic
931978705 2:67671044-67671066 AAGGACAGGATGAGAACAACTGG - Intergenic
932073274 2:68642419-68642441 GAGAATAGCATGGGAAAAACAGG + Intergenic
932524732 2:72452532-72452554 AAAGACCTCATGGGGAAAACAGG + Intronic
932847437 2:75150420-75150442 AAGAAAAGCATGGGAAAGACAGG - Intronic
932847718 2:75152353-75152375 GAGAACAGCATGGGAAACACTGG - Intronic
933096897 2:78195590-78195612 TAGGACAGTTTGAGTAAAACTGG - Intergenic
933350252 2:81145028-81145050 AAGAATAGCATGGGAAAGACTGG + Intergenic
933391528 2:81674942-81674964 AGGGACAGCATGGCAAAAACAGG + Intergenic
933602193 2:84344456-84344478 AAGAATAGCATGGGAAAAACTGG - Intergenic
935166900 2:100577871-100577893 AAGACCAGCCTGGGTAACACAGG - Intergenic
935176994 2:100657437-100657459 GAGGAGACCATGGCTAAAACAGG - Intergenic
935788444 2:106570001-106570023 CAGGACAGCCTGGGTCAAACTGG + Intergenic
936443472 2:112576744-112576766 AAGGACAGCCTGGGTAATATAGG + Exonic
936503528 2:113085791-113085813 AAGGACAGGTTGGAAAAAACAGG + Intergenic
936594983 2:113839274-113839296 AAGGCCAGCCTGGGCAACACAGG - Intergenic
936670840 2:114654119-114654141 TAGGACAGTAGGGGTAAAACTGG - Intronic
936789254 2:116131362-116131384 AAGGACATTATTGATAAAACTGG + Intergenic
937178003 2:119961731-119961753 TACTACAGCATGGGTAAACCTGG + Intronic
939016750 2:136912649-136912671 AAGAATAGCAGGGGAAAAACTGG - Intronic
939539908 2:143481176-143481198 AAGGACATCAAGGGCAAAGCTGG - Intronic
939887958 2:147701830-147701852 GAGAACAGCATGGGGGAAACAGG + Intergenic
940064105 2:149607508-149607530 AAGAATAGCATGGGAAAGACTGG - Intergenic
940193043 2:151062662-151062684 AAGAATAGCATGGGTAAGAGTGG + Intergenic
940852431 2:158701395-158701417 GAAGACAGCCTGGTTAAAACAGG - Intergenic
941332857 2:164200993-164201015 TGGGACAACATGGATAAAACTGG + Intergenic
941477389 2:165966707-165966729 GAGAACAGCATGGGAAAGACTGG - Intergenic
941560146 2:167034926-167034948 AAGAATAGCATGGGAAAGACTGG - Intronic
941741751 2:169043159-169043181 AAGAATAGCATGGGAAAGACTGG - Intergenic
942123349 2:172800422-172800444 AAGGCCAGCATGGGTAGATATGG - Intronic
943301417 2:186207341-186207363 GAGAACAGCATGGGGAAAAACGG + Intergenic
943427496 2:187753907-187753929 GAGAATAGCATGGGTAAGACTGG + Intergenic
944778568 2:202994508-202994530 AAGGACAGCCTGGGCAACATAGG - Intronic
945233630 2:207614199-207614221 AAGACCAGCCTGGGTAACACAGG + Intronic
945710903 2:213293075-213293097 AAGAGCAGCATGGGGGAAACTGG - Intronic
947527988 2:230891044-230891066 AAGAACAGCCTGGGAAACACAGG + Intergenic
947687313 2:232099641-232099663 TAGAACAGCTTGTGTAAAACAGG + Intronic
948326701 2:237127882-237127904 ACAGACAGCAAGGGTACAACAGG - Intergenic
1169420565 20:5455615-5455637 AAGACCAGCATGGGCAACACAGG + Intergenic
1169488856 20:6054805-6054827 GAGAACAGCATGGGAAAGACTGG - Intergenic
1169773832 20:9230379-9230401 AAGGAGAACATAGGTAAAGCAGG + Intronic
1170248454 20:14250537-14250559 AAGGACACAATGGCTCAAACAGG - Intronic
1171008759 20:21494521-21494543 AAGGACAGCAGTGGGGAAACCGG + Intergenic
1171571617 20:26256433-26256455 AAGAATAGCATGGGAAAGACTGG - Intergenic
1171573458 20:26276158-26276180 AAGAATAGCATGGGAAAGACCGG + Intergenic
1171792718 20:29543308-29543330 AAGAATAGCATGGGAAAGACCGG + Intergenic
1171806643 20:29687258-29687280 AAGAATAGCATGGGAAAGACCGG + Intergenic
1171837406 20:30169253-30169275 AAGAATAGCATGGGAAAGACCGG - Intergenic
1171855751 20:30341094-30341116 AAGAATAGCATGGGAAAGACTGG - Intergenic
1173450419 20:43158717-43158739 AAGGACACCTTGTGTAAAATAGG + Intronic
1174424423 20:50422119-50422141 AAGGCCAGCATGGCTGGAACTGG + Intergenic
1174951173 20:55042512-55042534 AAGAATAGCATGGGAAATACTGG - Intergenic
1175374095 20:58513188-58513210 GAGGACAGGATGGGGAAACCGGG - Intronic
1176933817 21:14843603-14843625 AAGAATGGCATGGGAAAAACTGG - Intergenic
1177514982 21:22137797-22137819 CATGACAGCATGGGTGAACCTGG + Intergenic
1178439381 21:32585985-32586007 AAGGACAGCCAGGGTTTAACAGG - Intronic
1178468881 21:32874346-32874368 AAGAATAGCATGGGAAAGACCGG + Intergenic
1179082755 21:38188518-38188540 TAGGACAGGTTGGGTAAAAATGG - Intronic
1180020620 21:45123502-45123524 AAGAACAGCCTGGGCAACACAGG - Intronic
1180139502 21:45884133-45884155 AAGGCCAGCCTGGGCAACACAGG - Intronic
1182207104 22:28639567-28639589 AACAACAGCATGGGAAAGACTGG - Intronic
1182330474 22:29548075-29548097 AAGAACAGCATGGGAAAGACCGG + Intronic
1182339977 22:29612537-29612559 AAGACCAGCCTGGGTAACACAGG - Intronic
1182383782 22:29917445-29917467 AAGGCCAGCCTGGGCAACACAGG + Intronic
1182670925 22:31995321-31995343 AAGACCAGCCTGGGTAACACAGG - Intergenic
1182874147 22:33675555-33675577 AAGGCCAGTGTGGGTGAAACAGG + Intronic
1182909753 22:33972347-33972369 AAGACCAGCATGGGCAACACAGG + Intergenic
1183139207 22:35920301-35920323 AATGACAGCATGAGAAAAACTGG - Intronic
1183549413 22:38472574-38472596 AAGGGCAGCAGTGGGAAAACTGG + Intronic
951192656 3:19787561-19787583 AAGAATAGCATGGGAAAGACTGG - Intergenic
951395457 3:22160025-22160047 AAGAACAGCATGGGGAAAACTGG - Intronic
951560663 3:23963279-23963301 AAGGACTTCATGGTTTAAACTGG - Intronic
952986986 3:38794327-38794349 GAGGGCAGCATGGCTAAATCTGG - Intergenic
953635262 3:44658162-44658184 ACGGACAGAAAGGGTAACACTGG - Intronic
954694368 3:52413063-52413085 AGGGACAGCACTGGTAAGACAGG - Intronic
955128879 3:56143443-56143465 GAGAACAGCATGGGAAAGACTGG - Intronic
956185545 3:66559092-66559114 AAGAACAGCACGGGAAAGACTGG + Intergenic
956973401 3:74552733-74552755 AAGGACAGCGTGGGGGAAACCGG - Intergenic
957615222 3:82518071-82518093 AAGAATAGCATGGGAAAGACCGG + Intergenic
957787590 3:84901927-84901949 AAGAATAGCATGGGAAAGACCGG - Intergenic
958426841 3:93988748-93988770 AAGGGGAGCATAGGGAAAACAGG - Intronic
958911279 3:99996770-99996792 GAGAACAGTATGGGGAAAACCGG + Intronic
959110680 3:102118692-102118714 TAGGACAACATGGGTGAACCGGG - Intronic
959172392 3:102859253-102859275 GAGAACAGCATGGGAAAGACTGG + Intergenic
960088720 3:113617134-113617156 CAGGACAGCAGGTGTAAACCAGG + Intronic
960110051 3:113837169-113837191 AAGACCAGCCTGGGCAAAACAGG - Intronic
960126823 3:114007938-114007960 AAGGACAGTATTGTTAAAAATGG - Intronic
960224718 3:115156373-115156395 AAAGACCGCATTGATAAAACAGG - Intergenic
960654522 3:119988464-119988486 CAGGACAGAATTGGAAAAACTGG + Intronic
960714252 3:120559937-120559959 AAGAGCAGCATGGGGGAAACAGG + Intergenic
963267119 3:143250530-143250552 AAGAATAGCATGGGAAAGACCGG - Intergenic
963286941 3:143442519-143442541 AAGGCCAGCATGGCCAACACAGG + Intronic
963796170 3:149633187-149633209 AAGGACAGCCTGGGCAACATAGG + Intronic
964170442 3:153764104-153764126 GAGAACAGCATGGGGGAAACTGG - Intergenic
964317255 3:155457580-155457602 AAGGCAAGCATGGGTTAAATAGG - Intronic
964351140 3:155805261-155805283 AAGGCCAGCCTGGGCAACACAGG + Intronic
964898465 3:161627724-161627746 AAGAACAGCATGGGAAAACCTGG + Intergenic
965045620 3:163573214-163573236 AAGAATAGCATGGGAAAGACTGG - Intergenic
965674186 3:171177423-171177445 AAGGACAACTTGGTTAAACCTGG + Intronic
966374511 3:179281691-179281713 GAGGACAGCCTGGGTAACACAGG + Intergenic
968126722 3:196165643-196165665 AAGGAAAACATGGGGCAAACTGG + Intergenic
968244225 3:197125786-197125808 AATGACAGCATGAGTAACAGTGG + Intronic
969194770 4:5551791-5551813 AAGAACAGCACGGGAAAGACCGG - Intronic
969583645 4:8079868-8079890 AAGCACAGCATAGATAAAAGTGG + Intronic
969996199 4:11315765-11315787 AAGAACAGCCTGGGCAACACAGG + Intergenic
970705347 4:18794959-18794981 AAGAATAGCATGGGAAAGACCGG + Intergenic
970707873 4:18826720-18826742 AAGAACAGCACGGGAAAGACCGG + Intergenic
971198120 4:24488632-24488654 AAGGCCAGCATCTGTAAAAAGGG + Intergenic
971263047 4:25074569-25074591 GAGAACAGCATGGGGGAAACCGG + Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
972515781 4:39809424-39809446 GAGAATAGCATGGGGAAAACTGG - Intergenic
972540852 4:40037976-40037998 AAGGACATTAGGGGGAAAACTGG + Intergenic
972643959 4:40950510-40950532 AAGACCAGCCTGGGTAACACAGG + Intronic
972851125 4:43052139-43052161 AAGACCAGCCTGGGCAAAACAGG - Intergenic
972973004 4:44600409-44600431 AATAACAGCACTGGTAAAACAGG - Intergenic
974324568 4:60396946-60396968 AAGGAAAGCATAGATAAAAGAGG + Intergenic
974702887 4:65473596-65473618 AAGAACAACATGGGGGAAACTGG + Intronic
974867226 4:67596153-67596175 GAGAACAGCATGGGGCAAACCGG - Intronic
975361180 4:73474245-73474267 CAGAACAGCATGGAGAAAACTGG + Intergenic
976286293 4:83374662-83374684 AAGAATAGCATGGGAAAGACTGG + Intergenic
977030330 4:91875155-91875177 GAGAACAGCATGGGAAAAACTGG - Intergenic
978057322 4:104287543-104287565 TGTGACAGCATGGATAAAACTGG - Intergenic
978177569 4:105752071-105752093 TAGGACAGCTTTGGTAAAATGGG + Intronic
978192091 4:105925596-105925618 GAGAACAGCATGGGTTAAAATGG + Intronic
979538055 4:121846807-121846829 AAGGTCAGCATGGGTTGAAATGG + Intronic
980199186 4:129632947-129632969 GAGAATAGCATGGGAAAAACCGG + Intergenic
980300236 4:130981874-130981896 GAGAACAGCATGAGGAAAACTGG + Intergenic
980346717 4:131632099-131632121 AAGAACAGCATGGGGGAAACTGG - Intergenic
980635962 4:135503349-135503371 AAGAACAGCATGGGGAAAACTGG + Intergenic
981124022 4:141085255-141085277 GAGAACAGCATGGGAAAAACTGG + Intronic
981339835 4:143608774-143608796 AAGAATAGCATGAGTCAAACAGG + Intronic
981724499 4:147833267-147833289 AAGAACAGCATGGGGAAAACTGG - Intronic
981754075 4:148122229-148122251 AAGGAAAAAATGGGTAAAATTGG - Intronic
982029858 4:151289878-151289900 AAGACCAGCCTGGGCAAAACAGG + Intronic
982571151 4:157052088-157052110 GAGGACAGCATGGCTATAAATGG - Intergenic
982741147 4:159058712-159058734 AATGGAAGCATGGGTAAAAGTGG + Intergenic
982854238 4:160361650-160361672 AAGAAAAGCATGGGAAAAACCGG + Intergenic
983529121 4:168791561-168791583 AAGAACAGCATGGGGGAAACGGG + Intronic
983861943 4:172718430-172718452 AAGACCAGCGTGGGTAACACAGG + Intronic
986644473 5:9903310-9903332 AAGGACAACATGGATGAAACTGG - Intergenic
986869109 5:12027136-12027158 GAGAACAGCATGGGGGAAACTGG + Intergenic
987416933 5:17671463-17671485 AAGAACAGCATGGGGGAAACTGG - Intergenic
987806498 5:22775881-22775903 AAGAATAGCATGGGAAAGACCGG - Intronic
987894216 5:23924841-23924863 AAGAATAGCATGGGAAAGACGGG + Intergenic
988074939 5:26339988-26340010 TATGACAACATGGATAAAACTGG - Intergenic
988998237 5:36734941-36734963 AAGGACAGGCTGTGAAAAACAGG - Intergenic
989342732 5:40394306-40394328 AAGGACATCATGCCTAAAAGAGG + Intergenic
990155120 5:52868065-52868087 AAGCACATCATGGGCAAAAGTGG - Intronic
990364137 5:55052205-55052227 AAGAACTGCAGGGCTAAAACTGG - Intergenic
990524486 5:56611317-56611339 GAGAACAGCATGGGAAAGACTGG + Intergenic
990646147 5:57846709-57846731 AAAGATATCATGGGTAAACCTGG - Intergenic
991690910 5:69224189-69224211 AAGACCAGCCTGGGTAAAATGGG + Intronic
992075882 5:73192246-73192268 TAGAACAGCATGGGAGAAACTGG - Intergenic
993287009 5:86012321-86012343 AAGCCCAGCCTGGGCAAAACAGG + Intergenic
993618872 5:90145068-90145090 AAGAAAAGCATGGGGGAAACCGG - Intergenic
994006645 5:94845372-94845394 GAGGACACCATGGGAAAACCGGG + Intronic
995149552 5:108826450-108826472 AAGATCAGCCTGGGTAACACAGG - Intronic
995396966 5:111697229-111697251 AAGGACTGCAAGGGTAAAATCGG + Intronic
995728500 5:115209206-115209228 ATGGGCAGGATGGGTAAAATAGG - Intergenic
995958365 5:117808424-117808446 CATGACATCATTGGTAAAACTGG + Intergenic
996460329 5:123733484-123733506 AAGAACAGCACGGGAAAGACCGG - Intergenic
996591729 5:125155544-125155566 GAGAACAGTATGGGTGAAACTGG + Intergenic
996670449 5:126112133-126112155 AAGAATAGCATGGGAAAGACCGG - Intergenic
996673177 5:126143475-126143497 AAGAACAGCATGGGGGAAACTGG + Intergenic
997108387 5:131047011-131047033 AAGAATAGCATGGGAAAGACTGG + Intergenic
997181280 5:131831875-131831897 AAGAACAGCATAGGAAAGACTGG + Intronic
997346654 5:133197053-133197075 AAGGCCAGTTTGGGTCAAACTGG + Exonic
997506434 5:134421343-134421365 AAGAATAGCATGGGAAAGACCGG + Intergenic
998109121 5:139487566-139487588 AAGGCCAGCCTGGGCAACACAGG + Intergenic
999164175 5:149533756-149533778 AGGGACAGCATGTGGAGAACTGG + Intronic
999805035 5:155073214-155073236 GAGAACAGCATGGGAAAGACCGG + Intergenic
1000075759 5:157783935-157783957 AAGGCCAGCCTGGGCAAAACAGG + Intergenic
1000464475 5:161558752-161558774 AAGAACAGCATGGGTGAAACTGG - Intronic
1000661361 5:163943180-163943202 AAGGCCAGCCTGGGCAACACAGG - Intergenic
1000774886 5:165407194-165407216 AAGAATAGCATGGGAATAACCGG - Intergenic
1001140050 5:169136919-169136941 AAGGCCAGCCTGGGCAAAATAGG - Intronic
1001172168 5:169429837-169429859 GGGGACAAGATGGGTAAAACAGG + Intergenic
1001215973 5:169856075-169856097 GAGAACAGCCTGGGGAAAACTGG + Intronic
1001851849 5:174974673-174974695 GAGAACAGCATGGGAACAACTGG + Intergenic
1003886386 6:10524903-10524925 AAGAACAGCTTGGATTAAACTGG - Intronic
1004830697 6:19474484-19474506 GAGAATAGCATGGGAAAAACTGG + Intergenic
1004831027 6:19476747-19476769 AAGAATAGCATGGGAAAAACTGG + Intergenic
1005228117 6:23666591-23666613 AAGAATAGCATGGGAAAGACTGG - Intergenic
1006067936 6:31475783-31475805 AAGAATACCATGGGAAAAACTGG + Intergenic
1006240575 6:32674115-32674137 AAGAATAGCATGGGAAAGACTGG - Intergenic
1006312472 6:33270593-33270615 AAGGTCAACCTGGGTAACACAGG + Intronic
1008060927 6:46996330-46996352 GAGAACAGAATGGGTAAAACTGG - Intergenic
1008123216 6:47641328-47641350 AAAGAAAAAATGGGTAAAACGGG - Intergenic
1008500012 6:52171208-52171230 AAGAATAACATGGGAAAAACGGG + Intergenic
1008652545 6:53577722-53577744 AAGGCCAGCCTGGGCAATACAGG + Intronic
1009044052 6:58216366-58216388 AAAAACAGCAGGGGGAAAACTGG + Intergenic
1009219880 6:60970634-60970656 AAAAACAGCAGGGGGAAAACTGG + Intergenic
1009798372 6:68502168-68502190 AATGACAGCAGGGATAAATCAGG + Intergenic
1009821882 6:68813108-68813130 AAGAATAGCATGGGAAAGACAGG - Intronic
1010344631 6:74797536-74797558 AAAGACAGCATGTGTAAATGTGG + Intergenic
1010868335 6:81007202-81007224 AAGAATAGCATGGGAAAGACTGG - Intergenic
1011202792 6:84855688-84855710 AGGGACAGCATGGATATACCTGG + Intergenic
1011222917 6:85076213-85076235 GAGAACAGCAAGGGAAAAACTGG + Intergenic
1012145478 6:95675254-95675276 AAGAATAGCATGGGAAAGACTGG + Intergenic
1012948758 6:105495542-105495564 AAGGACAGCAAGGGCAAGGCAGG - Intergenic
1013716550 6:112969119-112969141 GAGAACAGCATGGGGGAAACTGG + Intergenic
1014019277 6:116569183-116569205 AAGGACAGGATGGGAAAAATCGG + Intergenic
1014731090 6:125032074-125032096 AAGAATAGCATGGGAAAGACCGG + Intronic
1014742284 6:125159944-125159966 GAGAACAGCATGGGAAAGACCGG - Intronic
1015844319 6:137503722-137503744 AAGAACAGCATGGGAGAAACCGG + Intergenic
1016419878 6:143872777-143872799 AAGAATAGCATGGGAAAGACCGG + Intronic
1016437256 6:144049636-144049658 GAGAACAGCATGGGGAAAACTGG + Intronic
1016472704 6:144391269-144391291 AAGATCAGCCTGGGTAACACAGG - Intronic
1017576101 6:155806244-155806266 AAGAACAGCATGGGGGAAACTGG - Intergenic
1018358437 6:163041412-163041434 GAGAACAGCATGGGAGAAACTGG - Intronic
1018393650 6:163360195-163360217 AAGAACAGCCTGGGCAACACAGG - Intergenic
1020429845 7:8107643-8107665 AAGGACGTCATTGGAAAAACTGG - Intergenic
1020721112 7:11746373-11746395 AAGGACATCAGTGGAAAAACTGG - Intronic
1021390526 7:20087288-20087310 AAGGACAAAATGAGTAAAAGGGG - Intergenic
1021477972 7:21084368-21084390 GAGGACAGCAAAGGTACAACTGG + Intergenic
1021655961 7:22874257-22874279 AAGGCCAGCCTGGGCAACACAGG - Intergenic
1022218322 7:28287349-28287371 GAGAACAGCATGGGGGAAACTGG + Intergenic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1023948261 7:44820899-44820921 AACAACAGCATGGGCAACACAGG - Intronic
1024580702 7:50798179-50798201 AAGACCAGCGTGGGTAACACAGG - Intergenic
1024609221 7:51049350-51049372 AAGGAGGGCATCTGTAAAACTGG + Intronic
1024823078 7:53356789-53356811 AAGGACAAAAGGTGTAAAACTGG - Intergenic
1025285913 7:57660482-57660504 AAGAATAGCATGGGAAAGACCGG - Intergenic
1025300248 7:57814286-57814308 AAGAATAGCATGGGAAAGACCGG + Intergenic
1026119976 7:67528670-67528692 AAGAATAGCATGGGTAAGACCGG + Intergenic
1026532293 7:71210209-71210231 AAGAATAGCATGGGAAAGACTGG + Intronic
1027739971 7:81989170-81989192 AAGGACAGCGTGGCTTAACCAGG + Intronic
1028249564 7:88525457-88525479 AAGAATAGCATGGGAAAGACCGG + Intergenic
1028700209 7:93769175-93769197 AAGAATAGCATGGGAAAGACTGG + Intronic
1030340718 7:108376696-108376718 AAGGACAGTATGGGAAAACTGGG + Intronic
1030867303 7:114715058-114715080 AAGGACAGGATGGGGAAAAGGGG + Intergenic
1031378027 7:121051069-121051091 AAGGAGAGCAAAGGGAAAACAGG + Intronic
1032198036 7:129800496-129800518 AAGGCCAGCCTGGGCAACACAGG + Intergenic
1032653135 7:133900458-133900480 AAGGAAAGCTTGGGTCAGACTGG + Intronic
1032815810 7:135472838-135472860 AAGGCCAGCCTGGGAAACACAGG + Intronic
1034077210 7:148243641-148243663 AAGAACAGCATGAGAAAGACTGG + Intronic
1034320376 7:150174382-150174404 AAGAATAGCATGGGAAAGACTGG + Intergenic
1034589931 7:152130361-152130383 AAGGACATCATTGGAAAACCCGG + Intergenic
1034751708 7:153575045-153575067 AAGAACAGTATGGGGGAAACTGG - Intergenic
1035594452 8:844504-844526 AAGGACAGCATGGCTGGAAAGGG - Intergenic
1036098527 8:5751821-5751843 AAGAACAGCATGGGAAAGACCGG + Intergenic
1037572253 8:20168172-20168194 AAGGCCAGCCTGGGCAACACAGG + Intronic
1037602952 8:20413718-20413740 AAGGACAGCAGGGAGAATACTGG + Intergenic
1037645320 8:20787584-20787606 AAGCACACCATGTGTAGAACAGG - Intergenic
1037647411 8:20805125-20805147 AAGAACAGCATGGGAAAGACTGG + Intergenic
1038087146 8:24211265-24211287 AAGAACAGCATGGAGAAAACTGG - Intergenic
1038580206 8:28741651-28741673 AAGGCCAGCCTGGGCAACACAGG - Intronic
1038618014 8:29113617-29113639 AAAGACAGCATGGAAAATACTGG + Intronic
1038888220 8:31689549-31689571 GAGGCCAGCATGGGAAAAGCGGG - Intronic
1039930540 8:41984102-41984124 AAGAACAGCATGGGCATAGCTGG - Intronic
1041422687 8:57686491-57686513 AAGAACAGTATGGGGGAAACTGG + Intergenic
1041694827 8:60724933-60724955 AAGGACAGAATGTGCAAATCTGG + Intronic
1042085216 8:65099999-65100021 AAGAATAACATGGGAAAAACCGG - Intergenic
1042466546 8:69134842-69134864 AAGAATAGCATGGGAAAGACAGG + Intergenic
1042579911 8:70265278-70265300 AAGGCCACCATGTGTAAGACAGG + Intronic
1042734153 8:71969023-71969045 AAGGAAAGCAGGAGTGAAACTGG + Intronic
1043492357 8:80762511-80762533 GAGAACAGCATGGGGGAAACTGG + Intronic
1045535479 8:103023146-103023168 AAGGCTAGCATGGCTGAAACGGG + Intronic
1045825696 8:106395513-106395535 AAGAATAGCATGGGAAAGACTGG + Intronic
1046226476 8:111286604-111286626 AAGAACAGCATGGGGAAACAAGG + Intergenic
1046619875 8:116517651-116517673 AATGACAATGTGGGTAAAACTGG + Intergenic
1046842015 8:118869833-118869855 AAGGATAGCATAGGTAATAATGG + Intergenic
1047178803 8:122567739-122567761 GAGAACAGCATGGGGGAAACTGG + Intergenic
1047194718 8:122711248-122711270 TAGAACAGCATGGGAAAGACTGG - Intergenic
1047229546 8:122984792-122984814 GAGGACAGTATGGGCAAAAGTGG - Intergenic
1047331722 8:123895344-123895366 AAGGACATCATGGGTACACTTGG + Intronic
1047849512 8:128841545-128841567 AAGAACAACATGGATGAAACTGG + Intergenic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1049738902 8:144225366-144225388 AAGATCAGCCTGGGTAACACAGG - Intronic
1049793916 8:144487567-144487589 AAGGCCAGCCTAGGCAAAACAGG - Intronic
1050411533 9:5371413-5371435 GAGAATAGCATGGGAAAAACTGG - Intronic
1050770308 9:9190353-9190375 AAGAATAGCATGGGAAATACTGG - Intronic
1052204429 9:25821965-25821987 TAGGACAACATGAGTAAACCTGG - Intergenic
1052336745 9:27328024-27328046 AAGGCCAGCTTGGGTAAAATAGG + Exonic
1052381681 9:27778417-27778439 GAGAACAGCATGGGAAAGACTGG - Intergenic
1052507820 9:29378065-29378087 AAACACAGAATGGGTAAAAAAGG - Intergenic
1052849618 9:33369040-33369062 AAAGATAGCATGGGATAAACGGG - Intronic
1052874951 9:33551800-33551822 AAGGACAGCATGGGTAAAACTGG - Intronic
1053501069 9:38592523-38592545 AAAGACAGCATGGGTAAAACTGG + Intergenic
1055003778 9:71483035-71483057 AAGACCAGCATGGGTAACATAGG - Intergenic
1055025625 9:71716970-71716992 AAGACCAGCATGGGCAACACAGG + Intronic
1055878605 9:80971616-80971638 AAGAATAGCATGGGAAAGACTGG - Intergenic
1055897104 9:81190375-81190397 AAGACCAGCCTGGGTAACACAGG - Intergenic
1056430602 9:86524418-86524440 AAAGACAGTATTGGAAAAACAGG - Intergenic
1056710477 9:88988891-88988913 AATGACACCATGGGAAAAACTGG - Intergenic
1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG + Intergenic
1058213790 9:102206184-102206206 AAGTGCCACATGGGTAAAACAGG - Intergenic
1058283585 9:103149298-103149320 AAGAATAGCATGGGAAAAACTGG - Intergenic
1058649351 9:107160191-107160213 AAGAATAGCATGGGGAAGACTGG - Intergenic
1059549716 9:115216758-115216780 AGGAACAGCATGGGAAAGACCGG - Intronic
1060308012 9:122433930-122433952 GAGAATAGCATGGGAAAAACCGG - Intergenic
1061002671 9:127911113-127911135 ACGGCCAGTATGGGTAGAACAGG + Intronic
1062149299 9:135009317-135009339 GAGAGCAGCATGGGTAATACGGG - Intergenic
1062234431 9:135501111-135501133 GAGGACAGCACCGGTAACACTGG + Exonic
1062616686 9:137400122-137400144 AAGAATAGCATGGGAAAAACTGG + Intronic
1062617129 9:137402957-137402979 GAGAACAGCATGGGAAAGACCGG + Intronic
1185969595 X:4647760-4647782 GAGAACAGGATGGGGAAAACTGG + Intergenic
1186109388 X:6239887-6239909 AAGAACAGCATGGGAAAGACCGG + Intergenic
1186405560 X:9299272-9299294 AAGACCAGCCTGGGTAACACAGG + Intergenic
1187316255 X:18197860-18197882 AAGAATAGCATGGGAAAGACTGG - Intronic
1187390478 X:18883535-18883557 GAGGACAGCATGGGAGAAAAGGG + Intergenic
1188239616 X:27769393-27769415 AAGGACAGAATGGGTCTAATAGG + Intergenic
1188491675 X:30744676-30744698 GAGAACAGCATGGGGGAAACTGG + Intergenic
1191052425 X:56208062-56208084 AAGAACAGTATGGGGGAAACTGG + Intergenic
1192095655 X:68207863-68207885 CAGGACAACAGGGGTAAAGCAGG + Intronic
1193614688 X:83672432-83672454 AAGAGTAGCATGGGGAAAACTGG - Intergenic
1193683518 X:84551051-84551073 AAGAACAGCATGGGGAAAACTGG + Intergenic
1194856960 X:98942688-98942710 AAAGAAAGGATAGGTAAAACTGG + Intergenic
1195228198 X:102819350-102819372 AAGAATAGCATGGGAAAGACTGG + Intergenic
1195765224 X:108289151-108289173 AAGGACATCATTGGGATAACGGG + Intronic
1195868231 X:109456791-109456813 AAGGGCACCATGGGTGAAGCAGG - Intronic
1196091276 X:111746322-111746344 AGGGAGAGCACGGGAAAAACTGG - Intronic
1196771371 X:119297759-119297781 TGTGACAACATGGGTAAAACTGG - Intergenic
1197443994 X:126525952-126525974 AAGGCCAGCCTGGGCAACACAGG + Intergenic
1197755541 X:129991539-129991561 AAGAACAGCCTGGGCAACACAGG - Intronic
1198151685 X:133916677-133916699 AAGACCAGCCTGGGTAACACAGG + Intronic
1198224881 X:134636019-134636041 TAGGACAGCAGGTGTAACACAGG + Intronic
1198475955 X:136998634-136998656 GAGAATAGCATGGGAAAAACAGG + Intergenic
1199355689 X:146860856-146860878 CAGGACAGCATTGGAGAAACTGG - Intergenic
1199476594 X:148253500-148253522 GAGAACAGCATGGGGGAAACTGG - Intergenic
1200285361 X:154817215-154817237 AAGGAGAGCAAAGGGAAAACAGG - Intronic
1201313302 Y:12617839-12617861 AAGGACAGCCTGGGCAACATAGG - Intergenic
1201538955 Y:15085298-15085320 AAGAACAGCATGGGGGAAACTGG - Intergenic
1202348588 Y:23962252-23962274 AAGTACAGCATGGGCAAAACAGG + Intergenic
1202522186 Y:25707852-25707874 AAGTACAGCATGGGCAAAACAGG - Intergenic