ID: 1057682341

View in Genome Browser
Species Human (GRCh38)
Location 9:97200718-97200740
Sequence GGTGTTCACAAGACAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057682341_1057682346 6 Left 1057682341 9:97200718-97200740 CCACACACTGTCTTGTGAACACC No data
Right 1057682346 9:97200747-97200769 CTGCCTCCCCACATTAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057682341 Original CRISPR GGTGTTCACAAGACAGTGTG TGG (reversed) Intergenic
No off target data available for this crispr