ID: 1057685814 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:97233291-97233313 |
Sequence | TGATGCTCAGGACAGCCAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057685814_1057685819 | 5 | Left | 1057685814 | 9:97233291-97233313 | CCCACTGGCTGTCCTGAGCATCA | No data | ||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685814_1057685820 | 6 | Left | 1057685814 | 9:97233291-97233313 | CCCACTGGCTGTCCTGAGCATCA | No data | ||
Right | 1057685820 | 9:97233320-97233342 | ACCTATTGTCACAGCAACAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 628 |
||||
1057685814_1057685822 | 16 | Left | 1057685814 | 9:97233291-97233313 | CCCACTGGCTGTCCTGAGCATCA | No data | ||
Right | 1057685822 | 9:97233330-97233352 | ACAGCAACAAGGGAAAAATCAGG | 0: 1 1: 0 2: 3 3: 32 4: 415 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057685814 | Original CRISPR | TGATGCTCAGGACAGCCAGT GGG (reversed) | Intergenic | ||