ID: 1057685814

View in Genome Browser
Species Human (GRCh38)
Location 9:97233291-97233313
Sequence TGATGCTCAGGACAGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057685814_1057685819 5 Left 1057685814 9:97233291-97233313 CCCACTGGCTGTCCTGAGCATCA No data
Right 1057685819 9:97233319-97233341 CACCTATTGTCACAGCAACAAGG 0: 1
1: 0
2: 3
3: 158
4: 4085
1057685814_1057685820 6 Left 1057685814 9:97233291-97233313 CCCACTGGCTGTCCTGAGCATCA No data
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685814_1057685822 16 Left 1057685814 9:97233291-97233313 CCCACTGGCTGTCCTGAGCATCA No data
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057685814 Original CRISPR TGATGCTCAGGACAGCCAGT GGG (reversed) Intergenic