ID: 1057685819 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:97233319-97233341 |
Sequence | CACCTATTGTCACAGCAACA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4247 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 158, 4: 4085} |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057685814_1057685819 | 5 | Left | 1057685814 | 9:97233291-97233313 | CCCACTGGCTGTCCTGAGCATCA | No data | ||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685816_1057685819 | -7 | Left | 1057685816 | 9:97233303-97233325 | CCTGAGCATCACCCTGCACCTAT | 0: 1 1: 1 2: 0 3: 12 4: 138 |
||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685813_1057685819 | 16 | Left | 1057685813 | 9:97233280-97233302 | CCACGCACTCACCCACTGGCTGT | No data | ||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685812_1057685819 | 19 | Left | 1057685812 | 9:97233277-97233299 | CCTCCACGCACTCACCCACTGGC | No data | ||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685815_1057685819 | 4 | Left | 1057685815 | 9:97233292-97233314 | CCACTGGCTGTCCTGAGCATCAC | No data | ||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
||||
1057685810_1057685819 | 23 | Left | 1057685810 | 9:97233273-97233295 | CCTTCCTCCACGCACTCACCCAC | 0: 1 1: 2 2: 9 3: 77 4: 906 |
||
Right | 1057685819 | 9:97233319-97233341 | CACCTATTGTCACAGCAACAAGG | 0: 1 1: 0 2: 3 3: 158 4: 4085 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057685819 | Original CRISPR | CACCTATTGTCACAGCAACA AGG | Intergenic | ||