ID: 1057685820

View in Genome Browser
Species Human (GRCh38)
Location 9:97233320-97233342
Sequence ACCTATTGTCACAGCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 628}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057685810_1057685820 24 Left 1057685810 9:97233273-97233295 CCTTCCTCCACGCACTCACCCAC 0: 1
1: 2
2: 9
3: 77
4: 906
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685816_1057685820 -6 Left 1057685816 9:97233303-97233325 CCTGAGCATCACCCTGCACCTAT 0: 1
1: 1
2: 0
3: 12
4: 138
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685813_1057685820 17 Left 1057685813 9:97233280-97233302 CCACGCACTCACCCACTGGCTGT No data
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685814_1057685820 6 Left 1057685814 9:97233291-97233313 CCCACTGGCTGTCCTGAGCATCA No data
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685815_1057685820 5 Left 1057685815 9:97233292-97233314 CCACTGGCTGTCCTGAGCATCAC No data
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628
1057685812_1057685820 20 Left 1057685812 9:97233277-97233299 CCTCCACGCACTCACCCACTGGC No data
Right 1057685820 9:97233320-97233342 ACCTATTGTCACAGCAACAAGGG 0: 1
1: 0
2: 2
3: 33
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057685820 Original CRISPR ACCTATTGTCACAGCAACAA GGG Intergenic