ID: 1057685822

View in Genome Browser
Species Human (GRCh38)
Location 9:97233330-97233352
Sequence ACAGCAACAAGGGAAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 415}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057685816_1057685822 4 Left 1057685816 9:97233303-97233325 CCTGAGCATCACCCTGCACCTAT 0: 1
1: 1
2: 0
3: 12
4: 138
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685815_1057685822 15 Left 1057685815 9:97233292-97233314 CCACTGGCTGTCCTGAGCATCAC No data
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685814_1057685822 16 Left 1057685814 9:97233291-97233313 CCCACTGGCTGTCCTGAGCATCA No data
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685813_1057685822 27 Left 1057685813 9:97233280-97233302 CCACGCACTCACCCACTGGCTGT No data
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685818_1057685822 -8 Left 1057685818 9:97233315-97233337 CCTGCACCTATTGTCACAGCAAC 0: 1
1: 0
2: 4
3: 49
4: 688
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685817_1057685822 -7 Left 1057685817 9:97233314-97233336 CCCTGCACCTATTGTCACAGCAA 0: 1
1: 0
2: 2
3: 23
4: 297
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415
1057685812_1057685822 30 Left 1057685812 9:97233277-97233299 CCTCCACGCACTCACCCACTGGC No data
Right 1057685822 9:97233330-97233352 ACAGCAACAAGGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057685822 Original CRISPR ACAGCAACAAGGGAAAAATC AGG Intergenic