ID: 1057691157

View in Genome Browser
Species Human (GRCh38)
Location 9:97287649-97287671
Sequence TCATATTTCAGGAGTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057691157 Original CRISPR TCATATTTCAGGAGTCTGGG TGG Intergenic
902351849 1:15861731-15861753 TGTTATTTCAGCATTCTGGGAGG - Intronic
903396901 1:23008436-23008458 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
903699134 1:25233191-25233213 TCATGGGTCACGAGTCTGGGTGG - Intergenic
903981475 1:27191764-27191786 TCAAATCTCAGCACTCTGGGAGG - Intergenic
905991792 1:42343777-42343799 ACATATTTAAGCAGTCTGTGTGG - Intergenic
906032617 1:42733514-42733536 TCTTATTTCATTGGTCTGGGTGG - Exonic
906390480 1:45411221-45411243 TCATGAGTCATGAGTCTGGGTGG - Intronic
907636542 1:56140757-56140779 TCATAATTCTGGAGGCTGGGAGG - Intergenic
907982932 1:59502538-59502560 ACAGATTCCAGGAGTGTGGGCGG - Intronic
908265338 1:62373287-62373309 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
908782734 1:67706468-67706490 CCCTGTTTCAGAAGTCTGGGAGG + Intronic
909391465 1:75125894-75125916 TAATACTTCAGGAGACTGGGAGG + Intergenic
912453037 1:109779039-109779061 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
912616084 1:111101745-111101767 TCATATCACAGGACTCTGTGCGG - Intergenic
913421324 1:118672965-118672987 ACATATTTCAGGCTTCTGAGTGG + Intergenic
916033925 1:160904126-160904148 TCATTTTTGAAGAGTCTAGGGGG - Intergenic
916350400 1:163843097-163843119 GCATAAATCAGTAGTCTGGGAGG + Intergenic
916881171 1:169020600-169020622 TCACATTTCAGGAGACTGGTGGG - Intergenic
917314277 1:173708506-173708528 CCATAGTTCTGGAGGCTGGGAGG - Intergenic
917862655 1:179162021-179162043 TCAGAGTTCTGGAGGCTGGGAGG - Intronic
918712509 1:187748769-187748791 TCACAGTTCAGGAAGCTGGGAGG - Intergenic
919066369 1:192696671-192696693 TCACAGTTCTGGAGTCTGAGTGG - Intergenic
922529761 1:226335507-226335529 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
923095399 1:230771441-230771463 CCTTATTTCAGGTGTCTGTGAGG - Intronic
923388462 1:233489605-233489627 TCATGAGTCATGAGTCTGGGTGG - Intergenic
1063610695 10:7559699-7559721 TCACAGTTCTGGAGGCTGGGAGG + Exonic
1063705254 10:8424063-8424085 TAATATTTCAATAGTTTGGGGGG - Intergenic
1065114367 10:22470368-22470390 TCATGGTTCTGGGGTCTGGGAGG + Intergenic
1067667372 10:48289860-48289882 TCACATTTTAGGAGGTTGGGTGG - Intergenic
1068045030 10:51875762-51875784 TCATGTTTCACAACTCTGGGGGG + Intronic
1070687538 10:78500210-78500232 TCATATCCCAGCAGTTTGGGAGG + Intergenic
1072588349 10:96803148-96803170 TCACGGCTCAGGAGTCTGGGTGG - Intergenic
1072706161 10:97682579-97682601 TCATATTTTGGGAGTATGAGTGG - Intronic
1073151579 10:101315170-101315192 CCATATATCTGGAGTCTGGTAGG + Intergenic
1074031517 10:109693520-109693542 TCATATATTAGGAGAGTGGGAGG + Intergenic
1076402809 10:130194702-130194724 TCATCTCTCAGGTGTCTGGCAGG + Intergenic
1078352238 11:10603902-10603924 TCATAGTTCTGGAGGCTGGAAGG - Intronic
1078758370 11:14232626-14232648 TCATATTGCAGGAGAGAGGGAGG - Intronic
1078941783 11:16014312-16014334 ACGTCTTTCAGAAGTCTGGGTGG - Intronic
1080432050 11:32208467-32208489 GCAGATTTGAGGAGTCTGTGGGG - Intergenic
1081062144 11:38492763-38492785 TCATATTTCAGACGTCTTGGAGG + Intergenic
1083243184 11:61404693-61404715 TCTCATTGCAGGAGTCTGGTTGG - Exonic
1084502599 11:69543743-69543765 TCATAGTTCTGGAGGCTGGGAGG - Intergenic
1085967383 11:81544172-81544194 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1086098546 11:83074366-83074388 TGATATTTGAGGAGTTGGGGAGG + Intergenic
1088100577 11:106150512-106150534 TCATATTTCATGTGTGTGTGTGG + Intergenic
1088499074 11:110464320-110464342 TCATGGTTCTGGAGGCTGGGAGG + Exonic
1089238760 11:117055936-117055958 TCATAGTTCTGGAGGCTGGGAGG - Intronic
1089393997 11:118123038-118123060 TCACAGTTCTGGAGACTGGGAGG - Intergenic
1089790756 11:120941835-120941857 TCATAGTTCTGGAGGCTGGAAGG - Intronic
1089917275 11:122170225-122170247 TCCTATTTCTGGAGGCTGGGAGG - Intergenic
1090288381 11:125520020-125520042 TCATGAGTCAGGAGTCTAGGTGG - Intergenic
1090800381 11:130167620-130167642 CCCTATCACAGGAGTCTGGGAGG + Intronic
1090918547 11:131188019-131188041 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
1092741336 12:11633013-11633035 TCTAATTTCAGCATTCTGGGAGG - Intergenic
1092937474 12:13377472-13377494 TCAGATGTCTGTAGTCTGGGTGG + Intronic
1093515594 12:19982855-19982877 TCACAGTTCTGGAGACTGGGAGG - Intergenic
1094018357 12:25887222-25887244 TCCTATCTAAGGGGTCTGGGAGG + Intergenic
1094090583 12:26644813-26644835 TCACAGTTCAGGAGGCTAGGAGG - Intronic
1094212621 12:27908585-27908607 TCACAGTTCTGGAGTCTGGGAGG + Intergenic
1094312527 12:29099910-29099932 TCATGATTCTGGAGACTGGGAGG - Intergenic
1094638993 12:32255037-32255059 TCACAGTTCTGGAGTCTGAGAGG + Intronic
1095636563 12:44440965-44440987 TAAAATTTCAGGAGTCTTTGGGG - Intergenic
1098051341 12:66457168-66457190 TCATATTTCAGAACACTGGGTGG - Intronic
1098132326 12:67363493-67363515 GCAAATTACAGGAGGCTGGGAGG + Intergenic
1098424020 12:70339113-70339135 TGAGATTTCAGGATTCTGGAAGG - Intronic
1101971292 12:109314672-109314694 TCATCTTTCAGGGCTCTGAGAGG + Intergenic
1102868848 12:116396599-116396621 TCTAATTTCAGCAGTTTGGGAGG - Intergenic
1104356796 12:128093984-128094006 TCATAGCACAGGAGTCTGGATGG + Intergenic
1104781933 12:131427594-131427616 TCATCTCTCAGGAGGCTGAGGGG - Intergenic
1105576789 13:21661269-21661291 TCATGATTCTGGAGGCTGGGAGG + Intergenic
1106431733 13:29687317-29687339 TCATGTTCCAGGAGTCTGTTAGG + Intergenic
1106874167 13:34054223-34054245 CCATATTTCAGGAGGCACGGGGG + Intergenic
1108499538 13:51057132-51057154 TCATATGTGAGGAGTCTGATAGG - Intergenic
1109887617 13:68562713-68562735 GAAAGTTTCAGGAGTCTGGGAGG + Intergenic
1110029415 13:70587381-70587403 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1110437365 13:75489990-75490012 GCATAATTCAGAAGTCTGTGTGG + Intergenic
1111456217 13:88487521-88487543 TCATGAGTCATGAGTCTGGGTGG - Intergenic
1113818487 13:113193060-113193082 TCATAGTTCTGGAGGCAGGGAGG - Intronic
1115824665 14:37255212-37255234 TCATATTTCAGATGACTGTGTGG + Intronic
1116014890 14:39394479-39394501 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1116334018 14:43634197-43634219 TTACATTTCTGGAGGCTGGGAGG + Intergenic
1116963268 14:50988851-50988873 TTAGATTTCAGGAGTCTTAGAGG + Intronic
1117194425 14:53325364-53325386 TCTTTTTTCAGGAGGCTTGGTGG + Intergenic
1117381007 14:55163019-55163041 TCAAACTTGAGGAATCTGGGTGG - Exonic
1117425897 14:55596560-55596582 TCATATTTCTGTTGTCTGGAAGG + Intronic
1117864466 14:60131127-60131149 TCATAGTTCTAGAGGCTGGGAGG - Intronic
1119424256 14:74525349-74525371 TCAACTTTCAGGAGACTGGAAGG - Intronic
1124592885 15:31068891-31068913 TCACATTTCTAGAGTCTGGGAGG - Intronic
1124912917 15:33940098-33940120 TCATAATTCTGCAGGCTGGGAGG - Intronic
1129261117 15:74367856-74367878 AGATATTTCAGGAGTCTGCTAGG - Intergenic
1131773384 15:95765660-95765682 TCAGATTTCAGGTACCTGGGAGG - Intergenic
1131862057 15:96664187-96664209 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1132912437 16:2321514-2321536 TCGTATTTCACGGGTCTGGCAGG - Intronic
1133552704 16:6873064-6873086 ACATATTTCAGAAGTTTGGGTGG - Intronic
1133953325 16:10417565-10417587 TAATATTTAATGAATCTGGGTGG - Intronic
1134600238 16:15528152-15528174 TCACAGTTCTGGAGTCTGGCTGG + Intronic
1137361818 16:47824822-47824844 TGTTATTTCAGCACTCTGGGAGG + Intergenic
1137502760 16:49024140-49024162 TCATAGCTCTGGAGGCTGGGAGG + Intergenic
1139346779 16:66308842-66308864 TCACAGTTCTGGAGGCTGGGGGG - Intergenic
1140512710 16:75519651-75519673 TCATGGTTCTGGAGGCTGGGAGG + Intergenic
1140802545 16:78501791-78501813 TCAGATTCCAGCAGTTTGGGAGG - Intronic
1141863751 16:86735768-86735790 TTATAGTTCTGGAGACTGGGAGG + Intergenic
1144743013 17:17594740-17594762 TCATAATTCAGGAGCCAGGGAGG - Intergenic
1144830782 17:18130133-18130155 TGTAATTTCAGGAGTTTGGGAGG - Intronic
1146366742 17:32234761-32234783 TCACAGTTCTGGAGGCTGGGAGG + Intronic
1146579429 17:34023740-34023762 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1149033032 17:52104961-52104983 TGATCTTTCATCAGTCTGGGTGG - Intronic
1149570512 17:57669040-57669062 TTATACTTCAGGAGTCTGCCCGG - Intronic
1150335629 17:64328523-64328545 TCTGATTTCAGGAGTCTGAGTGG + Intronic
1153038326 18:786054-786076 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1153249586 18:3108045-3108067 TCACAAGTCAGGAGTCTGGGTGG - Intronic
1153637088 18:7121944-7121966 TCATATTCCAGCACTTTGGGAGG - Intergenic
1153701663 18:7700649-7700671 TCATCTTCCAGGCGCCTGGGAGG - Intronic
1154107490 18:11534952-11534974 TCAAATTTCATGAATCAGGGAGG + Intergenic
1156535989 18:37865072-37865094 TCATAATTCAGAATTCTGGTTGG - Intergenic
1156708526 18:39913225-39913247 TCATAGTTCTGGAGCTTGGGAGG - Intergenic
1159078951 18:63713902-63713924 TGTTATTTCAGGATTCTGGCTGG + Intronic
1159504270 18:69314732-69314754 TTATACATCAGGAGGCTGGGTGG - Intergenic
1159598027 18:70402026-70402048 TCACAGTTCTGGAGTCTGGGAGG - Intergenic
1159911953 18:74153882-74153904 TTATATTTCAGAAGTCTGAATGG + Intronic
1161513522 19:4684313-4684335 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1164139904 19:22450053-22450075 TAATTTTCCAGCAGTCTGGGAGG - Intronic
1165563816 19:36706034-36706056 TCACAATTCTGGAGGCTGGGAGG + Intronic
926284878 2:11481434-11481456 TCACAGTTCACGAATCTGGGCGG - Intergenic
926630615 2:15132655-15132677 TCATAGTGGAGGAGTCTGGTGGG + Intergenic
926806105 2:16712872-16712894 TGATATTTTTGGAATCTGGGAGG - Intergenic
927041615 2:19236326-19236348 TAATATTTGAGGAGGCTGAGGGG + Intergenic
927405947 2:22766985-22767007 TCACATTTCTGGAGGCTGGATGG + Intergenic
928692591 2:33816411-33816433 TCACAGTTCTGGAGTCTAGGAGG + Intergenic
929267034 2:39929529-39929551 TCAGATGTGAGGAGTATGGGAGG + Intergenic
929441090 2:41966308-41966330 TCATATTTCGGGGGGCTGGGAGG + Intergenic
930883554 2:56298853-56298875 CCAAATTTCAAGAGTCTGGAGGG + Intronic
932104673 2:68931806-68931828 TCATATTCCAGGTCTCAGGGTGG - Intergenic
933258058 2:80102903-80102925 TCATAGTTCAGGACAGTGGGGGG + Intronic
933743553 2:85553519-85553541 ACATATTTCAGGAGTTTGGCTGG + Intronic
933781210 2:85802669-85802691 TCAAAGTTCTGGAGTCTGGAAGG - Intergenic
934796210 2:97102131-97102153 TCATAGTTCTGGAGGCTGGGAGG + Intergenic
936396735 2:112137435-112137457 TCACAGTTCTGGAGACTGGGAGG - Intergenic
937622903 2:124009386-124009408 TCAAATTGCAGGCCTCTGGGGGG + Intergenic
937915807 2:127098202-127098224 CCATATTTCAGGAGCCAGCGGGG + Intronic
939830148 2:147062001-147062023 TTGTATTCCAGGAGTCTAGGAGG - Intergenic
940093811 2:149951482-149951504 TCATAGTTCTGGATGCTGGGAGG + Intergenic
940450074 2:153826103-153826125 TTATACTTCTGGAGGCTGGGAGG + Intergenic
944285718 2:197947788-197947810 TCAGATTTCATTAATCTGGGTGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
946120273 2:217505694-217505716 TCACAGTTCTGGAGGCTGGGAGG - Intronic
946643651 2:221810613-221810635 GCTTATTTCAGGATTCTGTGAGG + Intergenic
948985604 2:241520798-241520820 TCACAGTTCAGGACTGTGGGAGG - Intergenic
1169334738 20:4746907-4746929 TCACCAGTCAGGAGTCTGGGAGG + Intergenic
1169431450 20:5539936-5539958 TCATGAGTCATGAGTCTGGGTGG - Intergenic
1170095382 20:12640332-12640354 TGCTATTTCAGGACACTGGGAGG + Intergenic
1171228300 20:23459856-23459878 GGATATTACAGGAGTCTGGATGG - Intergenic
1172886105 20:38231942-38231964 TCCTGTTCCAGGAATCTGGGCGG + Intronic
1175921249 20:62451468-62451490 TCATCCTTCAGGAGGCTGTGAGG - Intergenic
1176692016 21:9924690-9924712 TCATAGTTCTGGAGGCTGAGAGG - Intergenic
1176920591 21:14683477-14683499 TCATGGTTCTGGAGACTGGGAGG - Intergenic
1177203610 21:17985847-17985869 TCATGGTTCTGGAGGCTGGGAGG + Intronic
1177568271 21:22851908-22851930 TCACAATTCTGTAGTCTGGGAGG - Intergenic
1178457416 21:32768285-32768307 TGACAGTTCTGGAGTCTGGGAGG - Intronic
1179149831 21:38800292-38800314 TCATAGTTTGGGAGGCTGGGAGG - Intergenic
1179197601 21:39180395-39180417 TATGAATTCAGGAGTCTGGGAGG - Exonic
1182685424 22:32119424-32119446 TCAAATTTCATGAATCAGGGAGG - Intergenic
1182940508 22:34272068-34272090 TCATAGCTCTGAAGTCTGGGAGG - Intergenic
949741129 3:7235965-7235987 TCACAGTTCTGGAGGCTGGGAGG + Intronic
950964534 3:17137169-17137191 GCACCTGTCAGGAGTCTGGGAGG + Intergenic
951992094 3:28686754-28686776 TCATTTTTCAGAAGTCTTTGAGG + Intergenic
953603222 3:44387966-44387988 TAACATTTGAGGAATCTGGGTGG - Intronic
954354462 3:50073283-50073305 TCATGCTTCTGGAGGCTGGGAGG + Intronic
955476845 3:59346171-59346193 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
956040961 3:65144293-65144315 TCATAGTTCTGGAGCCCGGGAGG - Intergenic
956236512 3:67078182-67078204 TCATGGTTCTGGAGGCTGGGAGG - Intergenic
957956929 3:87199217-87199239 TCATCTTACAGGAGTGAGGGTGG + Intergenic
961082690 3:124039899-124039921 TCATTTTTCAGGAGCCTTTGGGG + Intergenic
961755726 3:129126324-129126346 TGATATTTTGGGATTCTGGGAGG - Intronic
961792459 3:129385984-129386006 TCAGATTACTGGAGTCTGAGAGG - Intergenic
961806429 3:129492550-129492572 TCAGATTACTGGAGTCTGAGAGG - Intronic
962149000 3:132872739-132872761 CCATTTTTCAGGAGTTTGGATGG + Intergenic
963800923 3:149675502-149675524 TCAAAAATCAGGAGGCTGGGTGG - Intronic
963806090 3:149724485-149724507 TTTTTTTTAAGGAGTCTGGGGGG - Intronic
964431315 3:156609284-156609306 TCATATTTCATGAGTCTGAATGG + Intergenic
964835032 3:160928843-160928865 TCATAGTTCTGGAAACTGGGAGG - Intronic
965313864 3:167166046-167166068 TCATATTTGAGGTATCTGTGTGG - Intergenic
965948745 3:174277374-174277396 CCATATTTTAGGAATCTAGGTGG + Intronic
969093316 4:4713133-4713155 TCATAGTTCTGGAGGCTGGGAGG + Intergenic
969110233 4:4839854-4839876 TTCCATTTCAGGGGTCTGGGAGG + Intergenic
970109582 4:12622835-12622857 TCTAATTCCAGGAGTTTGGGAGG + Intergenic
970229054 4:13890502-13890524 CCATATTCCAGGAAGCTGGGTGG + Intergenic
970829208 4:20316053-20316075 TCACATTTTTGGAATCTGGGAGG - Intronic
972271480 4:37514599-37514621 TTTTGTTTCAGGAGTCTGTGGGG - Intronic
973942920 4:55928342-55928364 TAATAATTCATGGGTCTGGGTGG - Intergenic
974413126 4:61567574-61567596 TCATCGTTCTGGAGGCTGGGAGG - Intronic
974469023 4:62295230-62295252 TCACATTTCTGGAGGCTGGGAGG - Intergenic
975181181 4:71347390-71347412 TTATAGTTCTGGAGGCTGGGAGG + Intronic
975850962 4:78572286-78572308 TCATATTCCCTGTGTCTGGGGGG + Intronic
976138726 4:81966981-81967003 TCACAGTTCTGGAGGCTGGGAGG + Intronic
978920772 4:114180627-114180649 TCATGACTCAGAAGTCTGGGAGG - Intergenic
980131441 4:128819855-128819877 CCATAGTCCAGGAATCTGGGAGG + Intronic
980174756 4:129330960-129330982 TCAAATTATAGGAGTCTGGCTGG + Intergenic
982693697 4:158575702-158575724 TCATAGTTCTGGAGACTGGGAGG - Intronic
984024471 4:174526305-174526327 TCAGATTTCAGAATTTTGGGGGG - Intergenic
984082861 4:175270592-175270614 TAAAATTTAAGTAGTCTGGGGGG - Intergenic
984339034 4:178430073-178430095 TCTTATTACTGGAGTCAGGGAGG - Intergenic
985935725 5:3096446-3096468 TTTTATTTCAGGAGTTTTGGGGG - Intergenic
986049068 5:4070265-4070287 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
986257838 5:6115459-6115481 TCATAATTCTGGATGCTGGGAGG - Intergenic
986291521 5:6403459-6403481 TTATAGTTCTGGAGGCTGGGAGG + Intergenic
987653342 5:20773568-20773590 TCATATTACAGGAATCTAGAGGG + Intergenic
987726019 5:21700694-21700716 ACATTGTTCAGAAGTCTGGGTGG + Intergenic
987835042 5:23149837-23149859 TCACATTTCTGGAGGCTGGAGGG + Intergenic
988024748 5:25670784-25670806 TCATAGTTGTGGAGGCTGGGAGG - Intergenic
988473621 5:31564040-31564062 TCATAGGTCACGAGTCTGGATGG - Intergenic
988513943 5:31889158-31889180 TCAGATTTCAAGTGGCTGGGTGG - Intronic
988519844 5:31935944-31935966 TAATTTTCCAGGAGTATGGGGGG - Intronic
988742233 5:34087917-34087939 TCATATTACAGGAATCTAGAGGG - Intronic
988954806 5:36304601-36304623 TCAGATTGCAGAAGTCTGGCTGG + Intergenic
989201266 5:38766471-38766493 TGATATTTCAAGATTCTGGTTGG + Intergenic
990155638 5:52874091-52874113 TCATGATTCTGGAGGCTGGGAGG + Intronic
991122734 5:63034163-63034185 TCATAATTCAGGAGCATTGGTGG + Intergenic
991431781 5:66555544-66555566 TCATAGTTCTGGAGGCTGGGAGG - Intergenic
992615029 5:78539277-78539299 TCACAGTTCTGGAGTCTGGGAGG - Intronic
992975656 5:82116547-82116569 TTTTATTTCAGGAGTGAGGGAGG + Intronic
993081464 5:83306715-83306737 TCTTATTGCTGGAGTCAGGGAGG - Intronic
993434677 5:87877519-87877541 TCATATTTCTGGAGACTGGTAGG + Intergenic
993938463 5:94030977-94030999 TCACAATTCTGGAGACTGGGAGG - Intronic
994232696 5:97326499-97326521 ACAGATTTTAGGTGTCTGGGGGG - Intergenic
994797885 5:104329847-104329869 TTATAGTTCAGGTGCCTGGGTGG - Intergenic
995027211 5:107438228-107438250 TCTTGTTTCAGGAGGCTGTGTGG - Intronic
995245221 5:109927791-109927813 TCACAGTTCTGGAGTTTGGGAGG + Intergenic
997345941 5:133192113-133192135 TCATCATTCTGGAGTTTGGGAGG - Intergenic
998998931 5:147898377-147898399 TTAGATTTCTGGATTCTGGGTGG + Intronic
999933540 5:156459943-156459965 ACATATTTGAATAGTCTGGGTGG - Intronic
1000572419 5:162931394-162931416 ACATATTTCTGGAGTCTATGTGG + Intergenic
1001725556 5:173894840-173894862 TCATCTTACATGCGTCTGGGAGG - Intronic
1001836841 5:174839772-174839794 TCACAGTTCTGGAGGCTGGGCGG - Intergenic
1002173522 5:177388354-177388376 TCACCTGTAAGGAGTCTGGGTGG - Exonic
1003629397 6:7773007-7773029 TCTTATTTCCAGAGTCTTGGAGG + Intronic
1003846910 6:10183201-10183223 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1004224950 6:13776676-13776698 TCACAATTCTGGAGGCTGGGAGG - Intergenic
1004232271 6:13844154-13844176 TCATAGTTCTGGAGGCTAGGAGG - Intergenic
1004742095 6:18472024-18472046 TAATATTTCAGCATTTTGGGAGG - Intergenic
1005033939 6:21537953-21537975 TCATGTTGCAGCATTCTGGGTGG - Intergenic
1005788329 6:29270347-29270369 TCAAAGTTCTGGAGGCTGGGAGG + Intergenic
1009623134 6:66101240-66101262 TCATAGTTCTGGATACTGGGAGG + Intergenic
1010800119 6:80165602-80165624 TATAATTTCAGGATTCTGGGTGG - Intronic
1011296129 6:85827837-85827859 TCTAATTTCAGCAGTTTGGGAGG + Intergenic
1012472859 6:99590487-99590509 TCATATTTGAGAGGCCTGGGAGG + Intergenic
1013063525 6:106660713-106660735 TCACAGTTCTGGAGGCTGGGTGG + Intronic
1013239429 6:108229527-108229549 TCATATTCCAGCACTTTGGGAGG - Intronic
1016917244 6:149255324-149255346 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1019429136 7:990741-990763 TCATATTTCAAATGTCTGAGGGG - Intergenic
1019587953 7:1815030-1815052 CCACCTTTGAGGAGTCTGGGTGG + Intergenic
1020556744 7:9679941-9679963 TCATAATTCTGGAGACTGAGAGG + Intergenic
1020638412 7:10725268-10725290 TCATAGTTCTGGAGGCTAGGAGG + Intergenic
1023589357 7:41764796-41764818 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1025173622 7:56783858-56783880 TCAAATTTAAGGAATCTGTGTGG - Intergenic
1026627293 7:72006853-72006875 AGTTATTTTAGGAGTCTGGGAGG - Intronic
1027793887 7:82667994-82668016 TCACATTTCTGGAGGCTGGCAGG + Intergenic
1028286467 7:89008992-89009014 TCATGATCCAGGAGTCTGGCAGG - Intronic
1029555049 7:101263029-101263051 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1029847118 7:103423734-103423756 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1030671672 7:112345063-112345085 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
1030913246 7:115279172-115279194 GTATATTTAAGGAGTGTGGGAGG + Intergenic
1031070275 7:117154328-117154350 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1031603325 7:123740032-123740054 TCATATTCCAAGATACTGGGAGG + Intronic
1033337021 7:140462568-140462590 TCATATTCTAGCACTCTGGGAGG + Intronic
1033385740 7:140873424-140873446 TCTTATTTCAGCACTTTGGGAGG - Intronic
1034686793 7:152978979-152979001 TCATAGTTCTGCAGCCTGGGAGG + Intergenic
1035002357 7:155623076-155623098 TCACATTTCCGGAGTCTAGCTGG - Intronic
1036607844 8:10323404-10323426 TCATATTTCAGTATTCTGGAGGG - Intronic
1037651748 8:20845430-20845452 TTATAGTTTAGGAGTCTCGGAGG + Intergenic
1037695416 8:21219334-21219356 TCATATTCTGGGAGGCTGGGAGG - Intergenic
1037749622 8:21672740-21672762 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
1038188144 8:25294256-25294278 CCATTGTTCATGAGTCTGGGTGG + Intronic
1039282399 8:36000083-36000105 TCACAGTTCTGGAGGCTGGGAGG + Intergenic
1039475665 8:37838118-37838140 CCATCTTTCAGGAGACAGGGAGG + Intronic
1040571612 8:48616427-48616449 TCAAATTTCAATAGTTTGGGGGG - Intergenic
1040825430 8:51615512-51615534 TCAAACTTAAAGAGTCTGGGGGG + Intronic
1041305047 8:56448998-56449020 TGACATTTCAGGAGTCTCAGGGG - Intergenic
1042642008 8:70946636-70946658 TCTTATTACAGGATTCTAGGAGG + Intergenic
1043128237 8:76427679-76427701 GCTTATTTCAGGCATCTGGGAGG + Intergenic
1043771362 8:84205851-84205873 TCATAGTTCTGGAGGCTGGATGG + Intronic
1045061516 8:98415237-98415259 TCATAATTCTGGAAGCTGGGAGG - Intronic
1045100195 8:98836238-98836260 TCACAGTTCTGGAGGCTGGGAGG + Intronic
1045136045 8:99219531-99219553 TCATAGTTCTGGAGGCTGAGAGG + Intronic
1045340219 8:101247137-101247159 TCATATTTCTGCAGTCAGGCAGG - Intergenic
1046138000 8:110055914-110055936 TGGCATTTCAGGAGTTTGGGAGG + Intergenic
1046361509 8:113164449-113164471 AAATATTTAAGGAGTCAGGGAGG - Intronic
1046613957 8:116455706-116455728 TCATTTCTCAGGAATCTTGGAGG + Intergenic
1046722098 8:117631940-117631962 TCTTATTTCAAAAATCTGGGTGG - Intergenic
1046913248 8:119652080-119652102 TCATAGTTCTGGAGGCTGGGAGG + Intronic
1047006968 8:120630543-120630565 ACATATTTCAGGATCCTGGCAGG - Intronic
1047047908 8:121075458-121075480 TCTTATTCCAGAAGTTTGGGAGG + Intergenic
1047824848 8:128562163-128562185 TTATAGTTCCGGAGGCTGGGAGG - Intergenic
1048007479 8:130431185-130431207 TGCTCTTACAGGAGTCTGGGAGG - Intronic
1050287113 9:4114921-4114943 ACATCATTCAGGATTCTGGGTGG - Intronic
1051139360 9:13961982-13962004 TCATATCTCAGAAATCTGAGTGG - Intergenic
1051303299 9:15677493-15677515 TTATATTGCAGGAGACAGGGTGG - Intronic
1051353367 9:16218754-16218776 TCATATTTCAGTAGGCAGAGTGG + Intronic
1051924796 9:22310656-22310678 TCATAAGTCATGAGTCTGGGTGG + Intergenic
1052672444 9:31575244-31575266 TCACAGTTCAGGAGGCTGGAAGG + Intergenic
1053777057 9:41555249-41555271 TCATAGTTCCGGAGGCTGAGAGG + Intergenic
1054364673 9:64323235-64323257 TCATAGTTCCGGAGGCTGAGAGG - Intergenic
1055728718 9:79258833-79258855 TCACATTTCTGGAGGCTGGAAGG - Intergenic
1056296491 9:85198422-85198444 TCATAATTCTGGAGTCTAGAAGG + Intergenic
1056912314 9:90713550-90713572 TCAAATTTCAGGATTATGGCAGG + Intergenic
1056971602 9:91209363-91209385 TCATATTTCAGAAGACGGGAAGG - Intergenic
1057522167 9:95768740-95768762 CCAAAGTTCTGGAGTCTGGGAGG - Intergenic
1057691157 9:97287649-97287671 TCATATTTCAGGAGTCTGGGTGG + Intergenic
1058094358 9:100842781-100842803 TCATATTTTAGGAGTTTTTGAGG + Intergenic
1058140898 9:101356119-101356141 TCACAGTTCTGGAGCCTGGGAGG + Intergenic
1058545565 9:106057940-106057962 TTACATTTCAAGAGTCTGGATGG - Intergenic
1058933788 9:109748765-109748787 TCACAATTCTGGAGTCTGGAAGG + Intronic
1059523712 9:114968759-114968781 AGGTATTTCAGCAGTCTGGGTGG + Intergenic
1060678409 9:125538271-125538293 TGCTATTTCAGCAGTCTAGGTGG + Intronic
1060908201 9:127326915-127326937 TCACAGTTCTGGAGGCTGGGAGG - Intronic
1061907466 9:133705988-133706010 CCACATTTCTGGAGACTGGGAGG - Intronic
1185660797 X:1727483-1727505 TCCTATCTAAGGGGTCTGGGGGG - Intergenic
1186590430 X:10924864-10924886 TCATAGTTCACGTGGCTGGGAGG + Intergenic
1187243268 X:17532119-17532141 TCATATTTTAGGAGTCTATGTGG - Intronic
1188286193 X:28327889-28327911 TCAAATTTTAGGGGTCTGGGAGG + Intergenic
1188298942 X:28483965-28483987 TCTTATTTGATTAGTCTGGGTGG - Intergenic
1190596683 X:52059310-52059332 TGATGTCTCAGGAGGCTGGGAGG + Intergenic
1190612141 X:52194763-52194785 TGATGTCTCAGGAGGCTGGGAGG - Intergenic
1190929587 X:54935958-54935980 TAATGTCTCAGGAGGCTGGGAGG - Intronic
1193052726 X:77118116-77118138 TCACAGTTCGGGAGGCTGGGAGG - Intergenic
1193180961 X:78456118-78456140 TCATGAGTCAGGAGTCTGGGTGG + Intergenic
1194745149 X:97620257-97620279 TCATAGTTCTGGAGGATGGGAGG + Intergenic
1195315147 X:103670095-103670117 TTATGTTTCTGGAGGCTGGGAGG - Intergenic
1196813140 X:119644429-119644451 TCATAGTTCTGGAGGCTGGGAGG + Intronic
1197446724 X:126559423-126559445 TCATATTTCTGGAGGCTAGAAGG + Intergenic
1198850390 X:140960305-140960327 TCACAGTTCTGGAGGCTGGGAGG - Intergenic
1199036428 X:143056054-143056076 TCACAATTCTGGAGGCTGGGAGG - Intergenic
1199080599 X:143572408-143572430 GCATATTACATGAGGCTGGGAGG - Intergenic
1200300361 X:154968367-154968389 TCACATTTCTGGGGGCTGGGAGG - Intronic