ID: 1057695760

View in Genome Browser
Species Human (GRCh38)
Location 9:97322014-97322036
Sequence CAGTGGAAGGTTCTGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057695748_1057695760 30 Left 1057695748 9:97321961-97321983 CCACGTGGGCTGCATGTGGAAGT 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG No data
1057695755_1057695760 -4 Left 1057695755 9:97321995-97322017 CCTGAGGGCAGTGGGAACTCAGT 0: 1
1: 0
2: 0
3: 28
4: 226
Right 1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057695760 Original CRISPR CAGTGGAAGGTTCTGAGCTG GGG Intronic
No off target data available for this crispr