ID: 1057696075

View in Genome Browser
Species Human (GRCh38)
Location 9:97323849-97323871
Sequence CCTGGAGTGCTCCCACCATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057696075_1057696083 7 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696083 9:97323879-97323901 GGAGGAGGACCTGGAGCTCTTGG 0: 1
1: 1
2: 3
3: 59
4: 493
1057696075_1057696086 21 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696086 9:97323893-97323915 AGCTCTTGGACGTGCGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1057696075_1057696080 -8 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696080 9:97323864-97323886 ACTCCAGGGCAAAGTGGAGGAGG 0: 1
1: 0
2: 2
3: 33
4: 316
1057696075_1057696087 22 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1057696075_1057696085 20 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696085 9:97323892-97323914 GAGCTCTTGGACGTGCGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1057696075_1057696082 -2 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696082 9:97323870-97323892 GGGCAAAGTGGAGGAGGACCTGG 0: 1
1: 0
2: 1
3: 42
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057696075 Original CRISPR CCTGGAGTGCTCCCACCATC TGG (reversed) Exonic
903237295 1:21958304-21958326 CCCGTAGTCCTCCCACCCTCTGG + Intergenic
905176815 1:36141498-36141520 CTTGTAGTGCCCCCATCATCAGG - Intronic
905873202 1:41416522-41416544 CCTAGTGTGCTCCCTGCATCTGG + Intergenic
906669470 1:47644040-47644062 CACTGAGAGCTCCCACCATCTGG - Intergenic
907366668 1:53966678-53966700 CCTGGGCTGCTTCCACCCTCTGG - Intronic
909662156 1:78096159-78096181 CCTAGAGTGCTCCCTCCAGGAGG - Intronic
910236406 1:85041132-85041154 CCTTGAAAGCTACCACCATCTGG + Exonic
911660507 1:100496533-100496555 CCGGGAGTGGTACCACGATCTGG + Intronic
919816824 1:201446395-201446417 CCTGGAGGGATCCCACCTTCAGG + Intergenic
920941835 1:210490689-210490711 TCTGGTGTGATGCCACCATCAGG - Intronic
922973659 1:229764791-229764813 CCTGGATTGCTTCCACCCTTTGG + Intergenic
1065038886 10:21670647-21670669 CCTGGATTTCTTCCACCACCAGG - Exonic
1066101575 10:32122731-32122753 CCTGGTGAGGTCCCACCTTCAGG - Intergenic
1067562364 10:47312782-47312804 CCTGGAGTGGTCTCACCGGCAGG - Exonic
1068958213 10:62840347-62840369 CTTGGATTGCTCCCACCTTTTGG + Intronic
1070383530 10:75902893-75902915 CCTTCAGAGCTCCCACCCTCTGG + Intronic
1070699841 10:78593731-78593753 CCTCAAGTGATCCCCCCATCTGG + Intergenic
1075688004 10:124377350-124377372 ACTGGAGTGCTACCCCCATGCGG - Intergenic
1076246534 10:128951214-128951236 CCTGGAGTTCTCTCTCCACCTGG - Intergenic
1078793208 11:14566021-14566043 CCAGGTATGCTCCCACCATGGGG - Intronic
1080687590 11:34528107-34528129 CCCACAGTGCTCCCAGCATCTGG - Intergenic
1084206351 11:67596357-67596379 CCTCAAGTGCTCCCTACATCAGG - Intergenic
1084860609 11:72015534-72015556 CCTGGAGTTCCTCCACCTTCCGG + Exonic
1087051203 11:93888074-93888096 CCTGGAGTGCTCCTTCCCTGAGG - Intergenic
1091135324 11:133183427-133183449 CTTGGAATTCTGCCACCATCAGG - Intronic
1091551008 12:1534872-1534894 CCTGGAGTGTCCCCACCAGAGGG + Intronic
1091671568 12:2455873-2455895 CCTGCAGTGCTCCCACATTGAGG - Intronic
1092663852 12:10772221-10772243 CCTTGAGTGTTCTCAGCATCAGG - Intergenic
1093059417 12:14587878-14587900 CCTGGACTGCTCACACCAAGAGG - Intergenic
1099635555 12:85206685-85206707 CCTGGAGGTCTCCGACAATCAGG + Intronic
1102257403 12:111424339-111424361 CATGGAGTGCTCCCAGCGCCAGG - Intronic
1104671074 12:130680688-130680710 CCAGGGCTGTTCCCACCATCTGG + Intronic
1105813885 13:24016246-24016268 CCTGGAGTGCTCCATCCTCCAGG + Intronic
1108432546 13:50368656-50368678 CCTGGAGGACACCCACCATGGGG - Intronic
1114037678 14:18645378-18645400 CCTGGAGGGCCACCACCACCAGG + Intergenic
1114120956 14:19669645-19669667 CCTGGAGGGCCGCCACCACCAGG - Intergenic
1114473493 14:22979440-22979462 CCTGTCCTGCTCCCACCCTCTGG + Intronic
1116320280 14:43454059-43454081 CCTGGTGAACTCACACCATCAGG + Intergenic
1121600510 14:95199797-95199819 ACTGGGCTGGTCCCACCATCTGG - Intronic
1121713149 14:96053839-96053861 CCTGGAGTGCTCCCTCCCCAAGG - Intronic
1121805949 14:96822945-96822967 CCAGGTGTGCTCCCACCTTAGGG + Intronic
1122342870 14:101039783-101039805 CCTGGACTGAAACCACCATCAGG + Intergenic
1123016993 14:105380426-105380448 CCTGGACTCCCCCCACCCTCAGG + Intronic
1125721851 15:41849039-41849061 CCTGGAGGGCTCATACCATGAGG - Intronic
1128952306 15:71898517-71898539 CCTTGAGAGCTCTCACTATCAGG + Exonic
1130263340 15:82376831-82376853 CCTGGATTTCTCCCTCCAACAGG + Intergenic
1130277965 15:82492835-82492857 CCTGGATTTCTCCCTCCAACAGG - Intergenic
1130470294 15:84220020-84220042 CCTGGATTTCTCCCTCCAACAGG - Intergenic
1130477782 15:84334587-84334609 CCTGGATTTCTCCCTCCAACAGG - Intergenic
1130493983 15:84453543-84453565 CCTGGATTTCTCCCTCCAACAGG + Intergenic
1130592583 15:85224648-85224670 CCTGGATTTCTCCCTCCAACAGG - Intergenic
1132172102 15:99669484-99669506 CCTTTAGTGCTCCCAACAACAGG + Intronic
1133291161 16:4722103-4722125 CCTGCGGTGCACCCACCTTCTGG + Intronic
1133366727 16:5216172-5216194 CCTGGATAGCTCCCACCAGATGG - Intergenic
1134786883 16:16952667-16952689 CTTGGAGTGCTTCCTCCGTCGGG - Intergenic
1138490493 16:57373504-57373526 CAGGGAGTGCCCCCACCATCTGG + Intronic
1140422011 16:74827316-74827338 CCTGGATTGCTGCAACCATTTGG - Intergenic
1140493927 16:75366739-75366761 TCTGGAGGGCTCCCATCTTCTGG + Intronic
1141837217 16:86549738-86549760 CCTTGAGTGATACCACCATGTGG + Intronic
1143491383 17:7287050-7287072 CTTGGACTCCTCCCACAATCTGG + Exonic
1146054319 17:29573649-29573671 CCTGCTGTGGTCCCACCCTCTGG - Exonic
1150629658 17:66870436-66870458 ACTAGAGTGCTACCAACATCTGG + Intronic
1152557707 17:81062646-81062668 CCTGTATTACTCCCACCATTTGG + Intronic
1152631192 17:81411367-81411389 CCAGCAGTGCTCCCACCCACAGG - Intronic
1154095931 18:11414676-11414698 CCTGGAGGGCTCCCAGCGTTAGG - Intergenic
1154502698 18:15004567-15004589 CCTGGAACCCTGCCACCATCGGG + Intergenic
1154505135 18:15030642-15030664 CCAGGAGTGATACCATCATCTGG - Intergenic
1157363092 18:47036467-47036489 ACTGGAGTGCTGCCACCTTTTGG + Intronic
1161138859 19:2636434-2636456 CCTGGCTTGTCCCCACCATCAGG - Intronic
1161411351 19:4119847-4119869 CGTGGACTGCTCCTTCCATCTGG + Intronic
1164579398 19:29425262-29425284 CCTGGAGTGCTGCAAACACCAGG - Intergenic
1165205492 19:34181653-34181675 CCTGGAGCTCTCCCAACATTTGG - Intronic
1166368981 19:42291124-42291146 CCCGCAGTGGTCCCACCACCAGG - Exonic
1168723663 19:58569317-58569339 CCTGGGGTGCTCCCTCCATGAGG + Exonic
924963846 2:57878-57900 CCTGGGGTGCTCACACCAAGGGG - Intergenic
926645467 2:15286021-15286043 CACGGAGTGATGCCACCATCTGG + Intronic
928703883 2:33926947-33926969 GCTGGAGTGATGCAACCATCAGG + Intergenic
932083924 2:68740509-68740531 CCTGGAGCCCTCTCTCCATCTGG + Intronic
932294856 2:70615859-70615881 CCTGGGGTGCTTCCAGCCTCTGG - Intronic
932793015 2:74672271-74672293 CCTGAAGTCCTCCTTCCATCTGG + Intronic
934873485 2:97890294-97890316 CCTGGAGTGCTCCAGGCAACTGG + Intronic
937204170 2:120225046-120225068 CCAGGAGCGCCCCCACCCTCCGG + Intergenic
937376914 2:121343400-121343422 CCTGGGTTGCTTCCACCTTCTGG - Intronic
937986798 2:127641629-127641651 CCTGGAGTGCCCCCACCGGGTGG - Intronic
938273295 2:129993685-129993707 CCTGGAGGGCCGCCACCACCAGG - Intergenic
938297233 2:130185824-130185846 CCTGGAGTGCTGGGACCCTCAGG + Intronic
938442925 2:131352416-131352438 CCTGGAGGGCCGCCACCACCAGG + Intronic
938504328 2:131860900-131860922 CCAGGAGTGATACCATCATCTGG - Intergenic
943588404 2:189767015-189767037 CTTGGATTGCTTCCACCTTCTGG + Intergenic
947706726 2:232282303-232282325 CATGGGGTGACCCCACCATCAGG + Intronic
948602586 2:239115836-239115858 CCTGGAGTGTTCCCAGGATCCGG - Intronic
948979481 2:241485630-241485652 CCTGGAGTCCTCCCTCCCTGAGG + Intronic
1168750970 20:280920-280942 CCTTGAGTGATCCTCCCATCTGG - Intronic
1170583011 20:17712862-17712884 GCTGGGTTGCTTCCACCATCTGG - Intronic
1171480656 20:25453564-25453586 CCTGAAGTGCTCTCACCAGGTGG + Exonic
1175000220 20:55619852-55619874 CCTGGATTGCTTCTACCATGTGG - Intergenic
1175392579 20:58636428-58636450 TCTGGTGAGCTCCCACCAACTGG - Intergenic
1176792714 21:13338434-13338456 CCAGGAGTGATACCATCATCTGG + Intergenic
1177303835 21:19286895-19286917 CTTGGAATTCTCCCTCCATCTGG - Intergenic
1178126004 21:29516381-29516403 CCAGCAGTAGTCCCACCATCTGG + Intronic
1179440755 21:41392245-41392267 CCTGGGCTGCTCCCACCTTTGGG - Intronic
1180176372 21:46092168-46092190 CCTGGTGTCCTCACCCCATCTGG + Intergenic
1180461807 22:15572420-15572442 CCTGGAGGGCCACCACCACCAGG + Intergenic
1180985844 22:19903564-19903586 CCTGGAGGGCTGCCTCCACCGGG - Intronic
1181468759 22:23125348-23125370 CCTGGACCCCTCCCACCATGTGG + Intronic
1181809654 22:25395643-25395665 CCTGGAGGGCACCCAGCACCCGG + Intronic
1182477995 22:30586993-30587015 CCTGGGGCTCTCCCACCATGGGG + Intronic
1182685491 22:32119781-32119803 CCTACAGGGCTCCCACCACCTGG + Intergenic
1182861481 22:33563176-33563198 CAGGGACTGCTCCCACCAGCTGG + Intronic
1183316894 22:37141862-37141884 CCTGGTGAGGTCCCACCTTCAGG + Intronic
1183666735 22:39250380-39250402 CCTGGAGTGAGCCCGTCATCAGG + Intergenic
1184588280 22:45462457-45462479 CTTGGACTTCTGCCACCATCTGG + Intergenic
1185179487 22:49350858-49350880 CCTGGGCTGCTTCCACCCTCTGG - Intergenic
951136250 3:19107375-19107397 CCTGGTGTGGCCCCACCTTCAGG - Intergenic
952357862 3:32601330-32601352 CCTGCTGTGTTCCCACCCTCTGG + Intergenic
953758404 3:45667096-45667118 TCTGGGGTCCTCCCAACATCTGG - Intronic
960628401 3:119703280-119703302 CCTGGCCAGGTCCCACCATCTGG - Intronic
962920206 3:139943659-139943681 CCAGGGGTGCTATCACCATCTGG + Intronic
962924293 3:139977337-139977359 CATGGTGTTCTCCCACCATGAGG - Intronic
963127203 3:141827228-141827250 CCTGCTGTGGTCCCACCTTCTGG - Intergenic
963591869 3:147270326-147270348 CCTGGAGTTCTCCAATCAACAGG - Intergenic
964933377 3:162052125-162052147 CCAGGAGTGCTCTCAGGATCCGG + Intergenic
966762295 3:183428735-183428757 CCCGGAGAGCTGCCGCCATCCGG + Intronic
968759464 4:2434595-2434617 CCTGCAGTGCTCTGACCAGCTGG - Intronic
978372931 4:108047216-108047238 CCTCATGGGCTCCCACCATCTGG - Intergenic
979799895 4:124895201-124895223 CCTGGACTTCTACCACCACCTGG + Intergenic
984698084 4:182799433-182799455 TCTCGAGTGCTCCCTCCACCCGG + Intronic
984713146 4:182902766-182902788 CCTGCAGAGCTCACACCAGCTGG + Intronic
985725248 5:1512662-1512684 CCTGGAGTCTTCCTCCCATCGGG + Intronic
986346276 5:6838102-6838124 CCAGGAATGCTCCCACCACAGGG - Intergenic
992032865 5:72740814-72740836 CTTGGATTGCTCCCACCTTTTGG + Intergenic
996090401 5:119345433-119345455 CCTGGATTGCTACCACCTTTTGG - Intronic
998237731 5:140414105-140414127 CTTGGATTGCTTCCACCATTGGG + Intronic
998441548 5:142166681-142166703 CCTGGACTCATCCCACCTTCCGG - Intergenic
999297469 5:150468620-150468642 CCTTGGCTGCCCCCACCATCTGG - Intergenic
1000087491 5:157900845-157900867 CTTGCTGTGCTCCCACCACCTGG - Intergenic
1001932598 5:175683895-175683917 CCTGGAAGGCAGCCACCATCAGG + Exonic
1001961272 5:175881705-175881727 CCTAGAGTCCTCCCACCCTTGGG + Exonic
1002006627 5:176239100-176239122 CCTGGAGCGCGGCCACCATCTGG - Intronic
1002219751 5:177671536-177671558 CCTGGAGCGCGGCCACCATCTGG + Intergenic
1002564284 5:180101168-180101190 CTTGCAGTGGTCCCACCCTCTGG + Exonic
1008231299 6:48987275-48987297 CATGGAGTGCTCCCTCGATATGG - Intergenic
1010986224 6:82427641-82427663 CCTGAAGTTCACCCACCCTCTGG - Intergenic
1011526100 6:88266579-88266601 CCTGGAGTGCTCCCAGGGGCTGG + Intergenic
1013126970 6:107193240-107193262 CCTGTACTGCTCTCTCCATCAGG + Intronic
1013912375 6:115292281-115292303 CCTGGACTGCTTCCACCCACTGG + Intergenic
1016199983 6:141395030-141395052 CCTGGTGAGGTCCCACCTTCAGG + Intergenic
1017797868 6:157864164-157864186 CCTTGAGTGCTCCCTCCTCCAGG + Intronic
1018730372 6:166645650-166645672 CCTGGAGTGCCCCCATCTCCAGG - Intronic
1019945573 7:4326216-4326238 CCTGGGTTGCTCCCACCTTTTGG + Intergenic
1019988790 7:4678100-4678122 CTTGGATTGCTTCCACCTTCTGG + Intergenic
1022403715 7:30066377-30066399 CCTGGAATACTTCCAGCATCTGG + Intronic
1023175851 7:37434709-37434731 GCTGGAGTGCTCCCTGCCTCAGG + Intronic
1023406063 7:39834376-39834398 CCTGGAGGGCCGCCACCACCGGG - Intergenic
1026845005 7:73693793-73693815 CCTGGAGTGCTCACATCCTCTGG + Intronic
1028262966 7:88686728-88686750 CCTGGCCTGCTCCCAGCATGGGG - Intergenic
1033240951 7:139679578-139679600 CCTGGAATTTTCCCCCCATCAGG - Intronic
1035791980 8:2315192-2315214 CCTGGGTTGCTTCCACCCTCTGG - Intergenic
1035800825 8:2406513-2406535 CCTGGGTTGCTTCCACCCTCTGG + Intergenic
1037295416 8:17395329-17395351 CTTGGATTGTTCCCACCATTTGG + Intronic
1039455231 8:37701504-37701526 CCTGGGGTGCTCCTACCACTGGG + Intergenic
1040586126 8:48743519-48743541 CCTGGCTTGTTCCCACCTTCAGG + Intergenic
1040621812 8:49100231-49100253 CCTGGAGTCCTTCCTCCAACAGG - Intergenic
1040656680 8:49518702-49518724 CCTGCAATCCTCCCACCATTTGG - Intergenic
1042958455 8:74277228-74277250 CCCGCTGTGCTCCCGCCATCTGG + Intronic
1048295622 8:133211641-133211663 TCTGGGCTGCTCCCTCCATCTGG - Intronic
1048398017 8:134033371-134033393 CCTGGTGTGTTCCAACCCTCTGG - Intergenic
1048818146 8:138353418-138353440 CTTGGGATGCTCCCACCTTCTGG + Intronic
1049195225 8:141312050-141312072 CCTGGACTCGTCCCAGCATCGGG - Intergenic
1049234388 8:141505095-141505117 GGTGGGGTGCTCCCACCACCGGG + Intergenic
1049276999 8:141724962-141724984 TCTCCAGTGCCCCCACCATCAGG + Intergenic
1049786572 8:144453810-144453832 CCTGGAGGGCTCCCAAACTCTGG - Intronic
1057609529 9:96528197-96528219 CCTGGATTGCTTCCACCTTTTGG + Intronic
1057696075 9:97323849-97323871 CCTGGAGTGCTCCCACCATCTGG - Exonic
1062449761 9:136610522-136610544 GCTGGAGGGCACCCACCCTCGGG + Intergenic
1062466237 9:136682852-136682874 CCTGGGCTGCTCCCACACTCAGG + Intronic
1062497585 9:136838933-136838955 CCTGGAACCCTGCCACCATCGGG - Exonic
1062536125 9:137021842-137021864 CCTGGAGTGCTGCCTGCCTCTGG - Intronic