ID: 1057696081

View in Genome Browser
Species Human (GRCh38)
Location 9:97323867-97323889
Sequence GGTCCTCCTCCACTTTGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057696081_1057696087 4 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1057696081_1057696092 30 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696092 9:97323920-97323942 GTTCCACTGGGGAGCTGAGGTGG 0: 1
1: 0
2: 0
3: 22
4: 279
1057696081_1057696086 3 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696086 9:97323893-97323915 AGCTCTTGGACGTGCGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1057696081_1057696090 19 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696090 9:97323909-97323931 TGCTGGGGACTGTTCCACTGGGG 0: 1
1: 0
2: 6
3: 16
4: 158
1057696081_1057696085 2 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696085 9:97323892-97323914 GAGCTCTTGGACGTGCGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1057696081_1057696089 18 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696089 9:97323908-97323930 GTGCTGGGGACTGTTCCACTGGG 0: 1
1: 0
2: 1
3: 10
4: 150
1057696081_1057696091 27 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696091 9:97323917-97323939 ACTGTTCCACTGGGGAGCTGAGG 0: 1
1: 0
2: 0
3: 16
4: 179
1057696081_1057696088 17 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696088 9:97323907-97323929 CGTGCTGGGGACTGTTCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057696081 Original CRISPR GGTCCTCCTCCACTTTGCCC TGG (reversed) Exonic
901382137 1:8881531-8881553 GGGTCTCCTCCATGTTGCCCAGG - Intergenic
903003860 1:20285464-20285486 GGTCCTCCTCTCCATTCCCCTGG - Intergenic
903190359 1:21652528-21652550 AGTCCCCTTCCCCTTTGCCCTGG + Intronic
904028591 1:27520205-27520227 GGGCCTCCTCCACAGTCCCCGGG + Intergenic
904536021 1:31199938-31199960 GGTTCCCCTCCACTGTGCCTAGG + Intronic
906275241 1:44510358-44510380 GGTGCTGCTCCACTGTGCCCTGG - Intronic
906345098 1:45010036-45010058 GGTTCTCATCCTCCTTGCCCAGG + Exonic
907954629 1:59216203-59216225 GGTTTTCCTCCACTTTCCCCAGG + Intergenic
908656443 1:66393937-66393959 GATCCTCCTGCACTATGTCCAGG - Intergenic
909426051 1:75526344-75526366 GGTACTCCCCTACTTTTCCCAGG + Intronic
912774999 1:112501193-112501215 GGTCCTCCTCCCCATTACCCCGG - Intronic
913958128 1:143321388-143321410 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
914052443 1:144146763-144146785 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
914126754 1:144819778-144819800 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
914665921 1:149832498-149832520 CCTCCTCCTCCACTCTGCTCAGG - Intergenic
914669844 1:149861296-149861318 CCTCCTCCTCCACTCTGCTCAGG + Intronic
915923795 1:160000581-160000603 GGTGCTCCTCCTCTTTGAACAGG + Intergenic
915939398 1:160109346-160109368 AGGCCCCCTCCACTTGGCCCAGG - Intergenic
917963666 1:180165482-180165504 TCTCCTCCTCCACCTTGCTCAGG + Intronic
917974320 1:180229610-180229632 CTTCCTCCTCCTCTTTCCCCTGG - Intergenic
918301959 1:183212785-183212807 GGTCCTCCTCCTGTTTTCCCTGG + Intronic
919749032 1:201025094-201025116 GGTGCTCCTCCTGTTTGCCATGG - Intergenic
920176122 1:204103002-204103024 AGTCCTTCTCCCCCTTGCCCTGG + Intronic
922352287 1:224744171-224744193 GCTCCTCCTCTCCTTTGCCTGGG - Intergenic
922984047 1:229852192-229852214 GATCCTCCTACACAATGCCCTGG + Intergenic
923987335 1:239395991-239396013 GGTCACCCTTCACTTTACCCTGG + Intronic
924209501 1:241749861-241749883 GCTCCTCATTAACTTTGCCCAGG + Intronic
1062873997 10:931252-931274 GGTCCTCCTCAACCCGGCCCCGG + Intronic
1063579318 10:7291498-7291520 GGTTCTCCTCCCCTATTCCCCGG + Intronic
1064265972 10:13825688-13825710 TGTCCTGCTCCACCCTGCCCAGG - Intronic
1069654585 10:70078369-70078391 TCTCCTCCTCCACGTGGCCCAGG - Intronic
1069836666 10:71313544-71313566 CTTCCTCCTCCACTTGGCCCAGG - Intergenic
1069979806 10:72244435-72244457 GCTTCTCCTCCCTTTTGCCCTGG + Intergenic
1070719394 10:78745775-78745797 GGGCCTGCCCCACTCTGCCCTGG - Intergenic
1070927068 10:80231427-80231449 GGTCTTTCACCACGTTGCCCAGG + Intergenic
1072895649 10:99364413-99364435 CCTCCACCTCCACTTTACCCTGG - Exonic
1073623041 10:105068445-105068467 GGTCCTCCTCTTCTTTTGCCTGG + Intronic
1075070248 10:119315535-119315557 TGGCCGCCTCCACTTTGCCCAGG + Intronic
1076514199 10:131033928-131033950 GCTCCTGCTCCACATTCCCCAGG - Intergenic
1076773223 10:132678645-132678667 AGTCCTCCACCACAATGCCCAGG - Intronic
1077289461 11:1782249-1782271 GGTCCTCCTCCCCTGTGCCCTGG + Intergenic
1078144350 11:8712861-8712883 GGTCCTCCTGCACTGTGAGCTGG - Intronic
1078246119 11:9574188-9574210 GGTCCTCCTCCAGCTCGCCGGGG - Exonic
1078726028 11:13931688-13931710 AGTCCTCCTCCGCTTAGCCTGGG - Intergenic
1080603247 11:33841507-33841529 GGTCCCCATCCACTGTCCCCTGG - Intergenic
1081527098 11:43934728-43934750 GGTCCTCCTCTGCTTTTCCCTGG - Intronic
1081625723 11:44654052-44654074 GGTCATCCTCCTCTTGCCCCAGG + Intergenic
1081771069 11:45650884-45650906 GGCCGTCCTCCTCCTTGCCCTGG - Exonic
1081808080 11:45900812-45900834 GCTCCTGCTCCACTTTCACCAGG - Intronic
1081933705 11:46890120-46890142 GGTCTTCCTGGACTTTCCCCAGG - Exonic
1082001427 11:47395422-47395444 GGTCCTGCCCCACCTTGCCTTGG + Intergenic
1082266001 11:50119101-50119123 AGTTCTTCTCCACTTTGCTCAGG - Intergenic
1082290087 11:50359471-50359493 AGTTCTTCTCCACTTTGCTCAGG + Intergenic
1083552834 11:63603276-63603298 GGTTCTCCTGAACTTTGCCATGG - Intronic
1084120590 11:67066716-67066738 TGACCACCTCCACTCTGCCCAGG + Exonic
1084154454 11:67305729-67305751 AGTCCTCCTCCCCTCTGCCTGGG - Intronic
1084978586 11:72816493-72816515 GGTCCTCTTCCACGTGGGCCTGG + Intronic
1085639678 11:78185507-78185529 ACTCCTCCACCACTTAGCCCTGG - Intronic
1086171660 11:83843224-83843246 GTTCCTCCTTGTCTTTGCCCAGG + Intronic
1089365194 11:117917191-117917213 CGTGCTCCTCCTCATTGCCCTGG - Exonic
1089749711 11:120642303-120642325 GGTCTTACTCCATCTTGCCCAGG - Intronic
1091622695 12:2101397-2101419 GAGCCTCCTGCACTTTGCCCGGG - Intronic
1093520170 12:20041018-20041040 GCTGCTCCTCTAATTTGCCCTGG - Intergenic
1096652622 12:53069320-53069342 GGACCTCCTCCACGTCTCCCTGG + Intronic
1098045117 12:66392428-66392450 AGTCCTCCTCCACATCCCCCAGG + Exonic
1102118227 12:110419767-110419789 ATTTCTCCTCCACTTTGCCGTGG - Intergenic
1102591053 12:113957087-113957109 GGGGCTGCTCCAGTTTGCCCGGG + Intronic
1102914850 12:116745065-116745087 GCTCCTCCTCCACTGGGCTCTGG - Intronic
1102969848 12:117157773-117157795 GCTCCTCCTCCACTGTGTCCTGG + Intronic
1104274385 12:127311668-127311690 CTTCCTCCTCCTCTTTTCCCCGG - Intergenic
1106407236 13:29484588-29484610 GGCCCTCCTTCACTTGGTCCAGG - Intronic
1107731761 13:43355997-43356019 GGTCCTCCTCCAGCTTGCGCCGG + Exonic
1112440248 13:99419845-99419867 TGTCCTCTTCCACCTGGCCCTGG + Intergenic
1113416555 13:110132796-110132818 GGCCCTCTTCCCCTGTGCCCTGG - Intergenic
1115191856 14:30754942-30754964 GCTTCCCCTCCACTTTGTCCAGG - Intergenic
1118736134 14:68703083-68703105 TGTCCTCCTCAGCTCTGCCCAGG - Intronic
1121094199 14:91204649-91204671 AGGCCTCCCCCATTTTGCCCTGG + Intronic
1121776434 14:96593756-96593778 TGTCTTCCTCCAGTTTTCCCAGG - Intergenic
1122018781 14:98819588-98819610 GATGCTCTTCCACATTGCCCAGG + Intergenic
1202853690 14_GL000225v1_random:37145-37167 GGTCCTCCTGGCTTTTGCCCGGG - Intergenic
1202856246 14_GL000225v1_random:53609-53631 GGTCCTCCTGGCTTTTGCCCGGG - Intergenic
1202930283 14_KI270725v1_random:28777-28799 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1123422100 15:20142740-20142762 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1123442981 15:20303894-20303916 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1123531328 15:21149280-21149302 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1124963400 15:34414912-34414934 GGTCATCTCCCACTTTGCCTGGG + Intronic
1124980021 15:34561138-34561160 GGTCATCTCCCACTTTGCCTGGG + Intronic
1131033523 15:89206113-89206135 TAACCTCCTCCACTTTCCCCTGG + Intergenic
1132844402 16:1993199-1993221 GGTCCACCCCCTCTTGGCCCCGG - Exonic
1135848438 16:25940350-25940372 TTTCCTCCTCCTCTTTGGCCTGG - Intronic
1136019053 16:27428393-27428415 GATCCTCCTCCTCTGTGCCGGGG - Intronic
1136718267 16:32301788-32301810 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1136773699 16:32860358-32860380 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1136836641 16:33508058-33508080 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1136841576 16:33546051-33546073 GGACCTACTCCACCCTGCCCTGG - Intergenic
1136896913 16:34001161-34001183 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1137687009 16:50393265-50393287 TGTCCTCCCTCACTTTGCCCCGG + Intergenic
1138145441 16:54605042-54605064 GTTCTTCCACCACTTTGCCCTGG + Intergenic
1139637954 16:68270258-68270280 GGTGCTCCTGCCCTTTTCCCAGG + Intronic
1141131579 16:81441237-81441259 GGTCCTCCACCAGTGTGGCCCGG + Intergenic
1141598217 16:85110237-85110259 GGTAATCCTGCACTTTGGCCAGG + Exonic
1141996607 16:87640009-87640031 GGTCATCCTCCACTTTGCGGGGG + Intronic
1142396760 16:89836412-89836434 GATCCTCCTCCACTGTCTCCAGG + Intronic
1203008161 16_KI270728v1_random:215977-215999 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1203076117 16_KI270728v1_random:1122469-1122491 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1203146826 16_KI270728v1_random:1808359-1808381 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1203151741 16_KI270728v1_random:1846348-1846370 GGACCTACTCCACCCTGCCCTGG - Intergenic
1143202106 17:5120325-5120347 GGTCATCCTCCACTGTGCTGGGG + Intronic
1146090390 17:29871723-29871745 GTTCCTCTTTCACTTTTCCCAGG - Intronic
1146464342 17:33074419-33074441 GGTCCTCCTCCCCTTTCCCCAGG + Intronic
1148406759 17:47422917-47422939 TGTCTTCTTCAACTTTGCCCTGG - Intronic
1150928427 17:69558550-69558572 GGACCTCAACCACTTTCCCCAGG + Intergenic
1151513857 17:74579690-74579712 GGGCTTCCACCACGTTGCCCAGG - Exonic
1151531989 17:74712537-74712559 GTTCCTCCTCTGCTTTTCCCTGG + Intronic
1151619842 17:75239018-75239040 CATCCTCTTCCACTTTGCCAAGG - Exonic
1151647250 17:75441737-75441759 GGTCCCCCTCCACATTGAACAGG + Intronic
1151759114 17:76090648-76090670 GGTCCTTCTCCGCTTTCCCTGGG - Intronic
1151977173 17:77489510-77489532 GGTCCTCCTCCTCCCAGCCCTGG - Intronic
1152024019 17:77797069-77797091 GATCCTCTTTCATTTTGCCCTGG + Intergenic
1152261709 17:79270719-79270741 GTTCCTCCTCCACTGGGCCTAGG + Intronic
1153275698 18:3365448-3365470 GGTCTTCCTCATCTTTTCCCTGG - Intergenic
1155510626 18:26572882-26572904 GGTCCTCCTCAAAATGGCCCAGG + Intronic
1157863526 18:51161964-51161986 GGTCTTCTGCCACTTTGCCTGGG - Intergenic
1160340791 18:78087138-78087160 GGGCCTCCGCCACACTGCCCAGG - Intergenic
1160534834 18:79586226-79586248 GGTCCTCCTACACCCCGCCCAGG + Intergenic
1161375539 19:3937627-3937649 GCTCCCCCTCCACTATCCCCCGG + Intronic
1161375575 19:3937718-3937740 GCTCCCCCTCCACTATCCCCCGG + Intronic
1161375780 19:3938269-3938291 GCTCCCCCTCCACTATACCCCGG + Intronic
1161725280 19:5925011-5925033 GGGCCTCCGCCACTGTGCACGGG + Intronic
1162462492 19:10821419-10821441 GGAGCTGCTCCACTTTGCCCGGG - Intronic
1162478293 19:10913921-10913943 ACACCTCCTCCACCTTGCCCGGG - Exonic
1165326653 19:35118024-35118046 GCACTTCCTCCACCTTGCCCTGG - Intronic
1165443192 19:35842532-35842554 GGTCCTCCTCATCTTCTCCCTGG + Exonic
1166933929 19:46319828-46319850 AGTCTTCCTCCTCTCTGCCCAGG + Intronic
1167354532 19:48995071-48995093 CCTCCTCCTCCTCCTTGCCCTGG - Intronic
1168649707 19:58085417-58085439 GGTCCTCCTCTCCCTGGCCCTGG - Intronic
1202691841 1_KI270712v1_random:99187-99209 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
925060382 2:885816-885838 GGTCCCCCTCAGCTTTGGCCAGG - Intergenic
928270954 2:29854094-29854116 TGTCCTCCTCCACCCTGCACAGG + Intronic
929810930 2:45188699-45188721 AGTCCTCCTCCTCTCTGACCTGG + Intergenic
931797250 2:65723055-65723077 GATTCTCCTCCAATTTGCCAAGG + Intergenic
933183354 2:79251722-79251744 GGTCCTCCCCAACTTGGGCCTGG + Intronic
933954549 2:87354769-87354791 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
934238746 2:90250989-90251011 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
934274451 2:91565721-91565743 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
934461170 2:94214320-94214342 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
937316118 2:120933089-120933111 GGTCCTGCTCCCCTCTCCCCAGG - Intronic
938240374 2:129738422-129738444 GGTGCTCCTCCATGTTTCCCTGG + Intergenic
939744967 2:145957353-145957375 GGTGCTCCCCCACTTTCCCTAGG + Intergenic
941582729 2:167319132-167319154 GGTCAACCTCCAGTGTGCCCTGG - Intergenic
942365667 2:175223722-175223744 GGGGCTCCACCACATTGCCCAGG + Intergenic
945986038 2:216354406-216354428 GGTCCTTCTCCAGCTTTCCCAGG + Intronic
946054420 2:216888398-216888420 GGACCTTCTACACTTTCCCCAGG + Intergenic
947461398 2:230307146-230307168 GGACCTCCTCCTCTTTGCTGAGG + Intronic
948862592 2:240760164-240760186 GCTCCTCCTCCACCTTCCACTGG + Intronic
1171455819 20:25271604-25271626 TGACCTGCTCCACATTGCCCTGG - Intronic
1172035051 20:32004699-32004721 GGTCCCCCTCCAAAGTGCCCAGG + Intergenic
1173647500 20:44642591-44642613 GCCCCCTCTCCACTTTGCCCTGG - Intronic
1174098479 20:48108337-48108359 TTTCCTCATCAACTTTGCCCAGG + Intergenic
1176232460 20:64039253-64039275 CGTCCTGCTCCACTTTGGACCGG + Intronic
1176592295 21:8657359-8657381 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1176768684 21:13048347-13048369 GGTCCTCCCCTATGTTGCCCAGG + Intergenic
1177804487 21:25860655-25860677 GGTGTTTCTCCATTTTGCCCAGG + Intergenic
1179018448 21:37616028-37616050 GGTCCTACTCCACATTACCTTGG + Exonic
1180275146 22:10634488-10634510 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1180549619 22:16529422-16529444 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1181028920 22:20140720-20140742 GGCCCCCCTCCACCCTGCCCAGG - Intronic
1181476095 22:23168695-23168717 TGGCCTCCTCCCCTTTGTCCAGG + Intergenic
1182149350 22:28017512-28017534 TGACCTCCTCCACTTTGTCCAGG - Intronic
1182442348 22:30371816-30371838 GGTTCCCTTCAACTTTGCCCTGG - Intronic
1183406247 22:37632039-37632061 CATCCTCTTCCATTTTGCCCGGG + Exonic
1183468015 22:37989847-37989869 GGGCCTGCTCCACCTTCCCCTGG + Intronic
1183712578 22:39514092-39514114 TGTCATCCTCCACTTGGCCCAGG + Exonic
1184090019 22:42288005-42288027 GGCCTGCCTCCTCTTTGCCCAGG - Intronic
1184516489 22:44965701-44965723 GGTCCTGCTCCACTGTTCCCAGG - Intronic
949422486 3:3880774-3880796 GGTCCAGCTCCATCTTGCCCAGG - Intronic
953856891 3:46506159-46506181 GACCCTCCTCCAGTTCGCCCTGG - Intergenic
954145857 3:48633990-48634012 GGTCCTCCTCCAGCTGCCCCGGG + Intronic
954293531 3:49662126-49662148 GGTCGTCCTCCACTGCGTCCCGG - Exonic
957146750 3:76434681-76434703 GGTCCTCCTCCCCGTTCACCAGG + Intronic
961175938 3:124835016-124835038 GGGCCTCCTACCCTTTCCCCAGG + Intronic
962198819 3:133384920-133384942 GGGGCTACTCCACTTTGGCCAGG - Intronic
962734672 3:138315370-138315392 GTTCCTCATGCACTGTGCCCTGG - Intronic
966748057 3:183297038-183297060 GGTACTCCTTGACTGTGCCCAGG + Exonic
968291551 3:197543357-197543379 AGCCCTTCTCCACTCTGCCCGGG + Intronic
969146273 4:5126536-5126558 GGTGCTCATCTACTTTGCCATGG - Intronic
972676984 4:41269434-41269456 GGTACTCCTCCAATTTGTCAAGG - Intergenic
975822007 4:78280371-78280393 TGTCCTGCTCCATCTTGCCCAGG - Intronic
981271046 4:142847091-142847113 GCCCCTCCTCCCCCTTGCCCCGG + Intronic
982468886 4:155762161-155762183 GGTTCTCCTCCCCTCTCCCCAGG - Intronic
986021549 5:3809048-3809070 CCTCCTCCTCCACTTTGGGCTGG + Intergenic
986944605 5:13000686-13000708 GGTCCTCCTGCAGTTTGCTTGGG - Intergenic
988231668 5:28487632-28487654 TGTCCTCCTCAACTTTCCCCAGG + Intergenic
990983983 5:61625734-61625756 GGGCCTCCACCCCTTTTCCCCGG + Intergenic
992095199 5:73356665-73356687 GGTCCTACTGTAGTTTGCCCTGG - Intergenic
994273156 5:97806233-97806255 GTGCCTCCTCCATTTTTCCCAGG + Intergenic
994904134 5:105814698-105814720 GGTTCTCCTCCTCCTTGCCCAGG + Intergenic
999113552 5:149142116-149142138 GATCCTCCTCTCCTTTGCCATGG + Intronic
999400295 5:151259032-151259054 GTTCCTCCTCCACATCCCCCAGG - Intronic
1000568717 5:162883461-162883483 GGTCCTCTTCCACGTTGTGCAGG + Intergenic
1001710667 5:173775424-173775446 GGCACTGCTCCAATTTGCCCTGG - Intergenic
1002663621 5:180807262-180807284 AGGCCTCCTGCCCTTTGCCCAGG + Intronic
1002664468 5:180812024-180812046 TGGCCTGCTCCACTTTTCCCAGG + Intronic
1002900537 6:1406539-1406561 TTTCCTCCTCCCCTGTGCCCTGG - Intergenic
1003624608 6:7729398-7729420 AGTCTTCCTCCCCTTTGTCCAGG - Intronic
1005997841 6:30942348-30942370 GACCCTCCTCCAAATTGCCCAGG - Intronic
1006986396 6:38178530-38178552 GGTCCCACTCCTCTATGCCCTGG - Intronic
1008021623 6:46584790-46584812 GGTCTCCCGCCACTTTCCCCAGG + Intronic
1008060331 6:46990158-46990180 ACCCCTCCTCCACTTTGCCCAGG + Intergenic
1008128361 6:47693216-47693238 GATCCTCCTCCTCCTTGGCCTGG - Intronic
1010148978 6:72708035-72708057 GGTCCTACTCTGTTTTGCCCTGG - Intronic
1014160671 6:118164786-118164808 TGTTCTCCTTCACTTGGCCCTGG + Intronic
1015555032 6:134452119-134452141 AGTCCTCCTCACCTCTGCCCAGG - Intergenic
1016647359 6:146425502-146425524 GGTCCTCTTCCAGGTTACCCTGG + Intronic
1019945684 7:4327333-4327355 TGTCCTCCACCACTGGGCCCAGG - Intergenic
1021408025 7:20296689-20296711 TGTCCTACTCCATTCTGCCCAGG - Intergenic
1021845139 7:24756874-24756896 AGTCCCCCTCCACTTTGCTCCGG - Intronic
1022041082 7:26582031-26582053 GGACTTCCTCCATTTTGCTCTGG + Intergenic
1032198464 7:129803162-129803184 AGGCCTCCGCCACCTTGCCCGGG + Intergenic
1033997543 7:147369758-147369780 GGCCCTCCTCAACTTTCACCTGG + Intronic
1035747903 8:1974530-1974552 GGTCCTCCGCCGCTGCGCCCGGG + Intronic
1035972241 8:4262243-4262265 GGGCATCCTCCACCATGCCCCGG - Intronic
1036988692 8:13566951-13566973 GCTCCTCATCTCCTTTGCCCAGG - Exonic
1039900258 8:41746737-41746759 CTTCCTCCTCCACCTTCCCCAGG - Intronic
1041111340 8:54485633-54485655 GGTTCTCCTCCACTCTGAACAGG - Intergenic
1041427387 8:57738290-57738312 ATTCCTCGTCCACTTTGCCTGGG + Intergenic
1042244128 8:66693979-66694001 CTCCCTCTTCCACTTTGCCCAGG + Intronic
1044375674 8:91467710-91467732 GGTCATCCCCCACTGTACCCTGG + Intergenic
1045127580 8:99109572-99109594 GGTGTTTCACCACTTTGCCCAGG + Intronic
1047541253 8:125768646-125768668 GGTTCTCTTGCCCTTTGCCCGGG + Intergenic
1048386272 8:133915574-133915596 GCTCCTCCTCCTCTTTGCCAGGG + Intergenic
1048494721 8:134925666-134925688 GCTCCTCCTCCACTTAGCATGGG + Intergenic
1052074746 9:24127388-24127410 GTTCCTCCTCCACTTGACACAGG - Intergenic
1053282005 9:36826579-36826601 GGTCCTCTTCCACATTCCCTGGG + Intergenic
1054273136 9:63047488-63047510 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1054302922 9:63390963-63390985 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1054401703 9:64717479-64717501 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1054435306 9:65201788-65201810 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1054495084 9:65819893-65819915 GGGCCTGCTCCACCCTGCCCTGG - Intergenic
1056305171 9:85283289-85283311 GGTACTCCTCCAATATGCCAGGG - Intergenic
1056602247 9:88055269-88055291 ACTCATCTTCCACTTTGCCCAGG + Intergenic
1057696081 9:97323867-97323889 GGTCCTCCTCCACTTTGCCCTGG - Exonic
1057704997 9:97389773-97389795 TCTCCTCCTCCACTTTGCCATGG + Intergenic
1058194888 9:101960479-101960501 GGTCCTCCGCCCCATTGCTCAGG + Intergenic
1058645906 9:107131300-107131322 GGTCCTCCCCCACTTCTCCTGGG - Intergenic
1059432344 9:114257755-114257777 CTTCCTCCTCCTCTTTTCCCTGG + Intronic
1060553856 9:124498550-124498572 GCTCCTCCTCCCCTCTGCACGGG + Intronic
1061266297 9:129507134-129507156 GGTCCTCTCCCACTTTTCCAAGG + Intergenic
1062096488 9:134706513-134706535 GGCCCACCCCCACTGTGCCCTGG + Intronic
1062135174 9:134923005-134923027 GGTCCTGCTCCACTTCCTCCTGG + Intergenic
1062301854 9:135878067-135878089 GGCCTTCCTCCACCTTTCCCTGG - Intronic
1203622349 Un_KI270749v1:136206-136228 GGGCCTGCTCCACCCTGCCCTGG + Intergenic
1189642971 X:43094230-43094252 GGTCCTCCACCACTTGGCTATGG - Intergenic
1190385049 X:49877483-49877505 GGTCCACCTGGACTCTGCCCAGG - Intergenic
1192259324 X:69494858-69494880 GGTGCTCCTCCTCATTCCCCAGG - Intergenic
1196736193 X:118982853-118982875 GTGCCTCCTCCACCTTGCCTAGG - Exonic
1196903200 X:120406854-120406876 GGAACTCCTCCACTTTCCTCTGG - Intergenic
1197716003 X:129706507-129706529 GGTCCTCCTAGTCTGTGCCCTGG + Intergenic
1197826587 X:130596597-130596619 GGTCCTCCTCCACTAATCCAGGG - Intergenic
1200091913 X:153640011-153640033 CGTGCCCCTCCACCTTGCCCGGG + Intergenic
1202583259 Y:26403198-26403220 GGGCCTGCTCCACCCTGCCCTGG - Intergenic