ID: 1057696087

View in Genome Browser
Species Human (GRCh38)
Location 9:97323894-97323916
Sequence GCTCTTGGACGTGCGTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057696081_1057696087 4 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1057696075_1057696087 22 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057696087 Original CRISPR GCTCTTGGACGTGCGTGCTG GGG Exonic