ID: 1057696087

View in Genome Browser
Species Human (GRCh38)
Location 9:97323894-97323916
Sequence GCTCTTGGACGTGCGTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057696075_1057696087 22 Left 1057696075 9:97323849-97323871 CCAGATGGTGGGAGCACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 170
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1057696081_1057696087 4 Left 1057696081 9:97323867-97323889 CCAGGGCAAAGTGGAGGAGGACC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057696087 Original CRISPR GCTCTTGGACGTGCGTGCTG GGG Exonic
901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG + Exonic
901836081 1:11925253-11925275 GCTCTTGGACATGCCAGCGGCGG - Exonic
906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG + Intergenic
911498472 1:98658797-98658819 GTTCATGGACGAGCGTGTTGAGG - Intergenic
915218702 1:154356827-154356849 GAACTTGGACTTGTGTGCTGGGG - Intergenic
924437479 1:244054965-244054987 GCTCGCGGAAGTGCGTGCTCAGG - Exonic
1063098836 10:2932232-2932254 GCTCTTGGTCCTTGGTGCTGAGG + Intergenic
1063242756 10:4188212-4188234 GCTCTGGGACGGGAGAGCTGCGG + Intergenic
1067713853 10:48671908-48671930 GCTCGTGGACCTGCGAGCTTGGG - Intergenic
1071826662 10:89332205-89332227 GCTCTTTGACCTGTGTGGTGAGG - Intronic
1076930327 10:133528055-133528077 GCTCTTGCGCGTGCGCTCTGTGG + Intronic
1076930658 10:133529692-133529714 GCTCTTGAGCGTGCGCTCTGCGG + Intronic
1077158005 11:1099954-1099976 GCTCGTGGTCGTGGGTGCCGTGG - Intergenic
1084591552 11:70093516-70093538 ACTCTTGGCTGTGTGTGCTGGGG + Intronic
1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG + Intronic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1098378594 12:69844242-69844264 GCTCTAGGACCTGCCTGATGTGG - Intronic
1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG + Exonic
1107731873 13:43356897-43356919 GCTCTTGCACGGGGCTGCTGTGG - Intronic
1122972742 14:105158977-105158999 GCACTGGGACGTGCGTGGGGTGG - Intronic
1132251109 15:100335987-100336009 GATCTTGGATGTGTGTGATGGGG - Intronic
1133300233 16:4777982-4778004 GGTCTTGGAGGTGGGAGCTGGGG + Exonic
1139283343 16:65788538-65788560 GCACATGGACCTGGGTGCTGAGG - Intergenic
1142848327 17:2692558-2692580 GCTGCTGGACGTGAGTGCTGGGG - Exonic
1160760725 19:782783-782805 GCTCCTGGACGTGGGTCCTTGGG - Intergenic
1161038610 19:2098535-2098557 CCTCTAGGACGTGGGAGCTGAGG - Intronic
937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG + Exonic
945516401 2:210768074-210768096 GCTCTTGGAGTTGCATACTGGGG + Intergenic
946245126 2:218383037-218383059 TCTCTGGGAGGTGCTTGCTGTGG - Exonic
947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
952128677 3:30333799-30333821 GCTCTTAGAGATACGTGCTGGGG - Intergenic
986308770 5:6535882-6535904 GCTCTTGGCCGTGGCTGGTGAGG - Intergenic
986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG + Intergenic
1005348501 6:24912145-24912167 GCTCTTGGGCGTTCTTTCTGGGG - Intronic
1006155047 6:32009370-32009392 GCGCGTGGACCTGCGGGCTGGGG - Intergenic
1006161358 6:32042105-32042127 GCGCGTGGACCTGCGGGCTGGGG - Exonic
1012164989 6:95937891-95937913 GCTCTTGGAAATGCGCGCAGAGG - Intergenic
1019121492 6:169808424-169808446 GTGCTTGGACGTCGGTGCTGGGG - Intergenic
1034496788 7:151427876-151427898 GCTCTTGGCTGTGGCTGCTGGGG - Intergenic
1034890934 7:154838665-154838687 GGTCTTGCACGTGCGTCCTTAGG - Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058870045 9:109193472-109193494 GGTTTTGGAAGTGAGTGCTGTGG + Intronic
1188628538 X:32319645-32319667 GCTATTGTACATGCGTGCTTAGG + Intronic
1199221869 X:145325985-145326007 GCTATTTGACGTGCTTGCTCTGG + Intergenic