ID: 1057699202

View in Genome Browser
Species Human (GRCh38)
Location 9:97350468-97350490
Sequence AGGTGTCCCTGCGCAGCTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057699198_1057699202 9 Left 1057699198 9:97350436-97350458 CCAGGAGTTGCTTAGCTATGTTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1057699202 9:97350468-97350490 AGGTGTCCCTGCGCAGCTTCCGG 0: 1
1: 0
2: 1
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057699202 Original CRISPR AGGTGTCCCTGCGCAGCTTC CGG Exonic
900970056 1:5986981-5987003 AGGTGGCCCCGGGCAGTTTCAGG - Intronic
901631257 1:10649276-10649298 AGGTGTACCTGCGCAGGTGAGGG - Exonic
904052556 1:27648541-27648563 AGTTCTCCCTGTGCAGCTCCAGG - Intergenic
906707700 1:47906854-47906876 AGGTCCCCCTGCTAAGCTTCTGG - Intronic
910035528 1:82783378-82783400 AGAAGTCCCTGGGCAGCTTCAGG + Intergenic
913089733 1:115468434-115468456 AGCTGTCACTGCACAGCTTGAGG - Intergenic
914922924 1:151859755-151859777 AGGTGCCCATGGGCAGCTTTTGG + Intergenic
915780222 1:158541772-158541794 AGAGGTTTCTGCGCAGCTTCTGG + Intergenic
916014142 1:160733635-160733657 ACGTGTATCTGCTCAGCTTCTGG + Intergenic
921003317 1:211067280-211067302 AGGATTCTCTGCCCAGCTTCAGG + Intronic
923389228 1:233497578-233497600 AGGTGCCCCTAGTCAGCTTCAGG + Intergenic
924824578 1:247525834-247525856 AGTAGTCCCTACGTAGCTTCAGG - Intronic
1063660270 10:8030892-8030914 TGGTGTCTCTGCTCACCTTCTGG + Intergenic
1065533530 10:26697389-26697411 CAGTCTCCCTGCACAGCTTCCGG + Intergenic
1066369332 10:34806844-34806866 AGGAGTCCCTGCACAGCTCAGGG + Intronic
1070581585 10:77724578-77724600 CAGTGGCCCTGCACAGCTTCAGG + Intergenic
1076022739 10:127087635-127087657 AAGTGTCCCTGTGCAGTTTAGGG + Intronic
1076532583 10:131154678-131154700 AGGTCTCCCTGCGCTCCTCCTGG - Intronic
1079319964 11:19443485-19443507 AGGTGTCCTTGCTCAGCATGTGG - Intronic
1083777986 11:64903498-64903520 AGGTGTCTCCCCGCAGCTGCTGG - Intronic
1084590218 11:70085924-70085946 TGGAGCCCCTGGGCAGCTTCCGG - Intronic
1084876750 11:72139005-72139027 AGGTGTCCTTGTGCAGCTCCTGG - Exonic
1084881771 11:72176811-72176833 AGGTGTCCTTGTGCAGCTCCTGG - Intergenic
1084887525 11:72220914-72220936 AGGTGTCCTTGTGCAGCTCCTGG - Exonic
1088847434 11:113680242-113680264 AGGGGTACCTGTGCAGCCTCTGG - Intergenic
1089499591 11:118924655-118924677 AAGTGTCCCTGCGCTGCTAAGGG - Intronic
1090602981 11:128391764-128391786 GTGTGTCCCTGTGCAGCCTCTGG + Intergenic
1091169380 11:133506854-133506876 AGCTGGCCCTGTGCAGGTTCGGG + Intronic
1094057760 12:26284004-26284026 AGGAGTCCCTGCGAAGCTGCTGG - Intronic
1102035165 12:109766793-109766815 AGATGCCCCTGCCCGGCTTCGGG - Intronic
1103070459 12:117936953-117936975 AGGCGTCCCTGGGCACCCTCTGG - Intronic
1105277769 13:18945610-18945632 AGGTGTTTCCCCGCAGCTTCAGG - Intergenic
1112526621 13:100154518-100154540 GAGTGTCCCTGCACAGCATCAGG - Intronic
1115447881 14:33512553-33512575 TGGGGTCCCTGAGCAGCTACAGG + Intronic
1117699141 14:58396047-58396069 CGGGGTCCCCGCGCCGCTTCCGG - Exonic
1118324689 14:64773052-64773074 AGGTGTGACAGCGCAGCTCCCGG - Intronic
1119724458 14:76913770-76913792 AGGTGTCGCTGCGCAGCCAGTGG + Intergenic
1120501878 14:85307773-85307795 AGGTATCCATGCCCAGCTTCAGG - Intergenic
1120905880 14:89620937-89620959 AGGTTGCCCTGGGCAGCTCCAGG - Intergenic
1122455659 14:101848696-101848718 GGGTGTCCCTGGGCTGCTCCAGG - Intronic
1123105827 14:105840675-105840697 ACGGGTGCCTGCGCAGCTGCGGG + Intergenic
1124797010 15:32791633-32791655 AGGTGTCTCTGCTCTGATTCAGG - Intronic
1124840375 15:33235818-33235840 AGGTGCCCCTGCTCAGCACCAGG + Intergenic
1127897461 15:63314648-63314670 AGCAGTCCCTAGGCAGCTTCAGG - Intergenic
1129538725 15:76334621-76334643 AGGTGTCCTGGCACAGCCTCAGG + Intergenic
1131922065 15:97338742-97338764 GGCGGTCCCTGGGCAGCTTCAGG - Intergenic
1132909857 16:2303891-2303913 AGGGGTCCCTGAGCAGGTACTGG + Intronic
1132956298 16:2595867-2595889 AGGTGTCCGTGCGGAGCAGCGGG - Intronic
1139787075 16:69402418-69402440 AGGTGTCCAAGTTCAGCTTCAGG + Intronic
1139846627 16:69925737-69925759 AGATGTCCCTGAGCAGCTGGGGG + Intronic
1140206874 16:72940347-72940369 AGATTTCCCTGTGCAGCTTCTGG - Intronic
1140981638 16:80115677-80115699 AGATGTTCCTGCACAGATTCTGG + Intergenic
1141239132 16:82248809-82248831 AGGTCTCCCTGGGCAGCTCCCGG - Intergenic
1143573292 17:7774911-7774933 AGGTGTGGCTGCACAGCCTCTGG - Exonic
1143865011 17:9917207-9917229 AGATGGGCCTGTGCAGCTTCGGG - Exonic
1143951760 17:10638234-10638256 CCAGGTCCCTGCGCAGCTTCAGG + Exonic
1149610546 17:57955413-57955435 AGCTGTCCCTGCGCGGCTGCCGG + Intergenic
1149667978 17:58379382-58379404 AAGTGTCTCTGAGCAGCGTCTGG - Intronic
1152303013 17:79506440-79506462 AGGTCACCCAGCGCAGCCTCTGG - Intronic
1152321471 17:79610624-79610646 AGGGGTCCCTGCGCGGGGTCGGG - Intergenic
1152706486 17:81846208-81846230 AGGTTTCCCTGAGGAGCATCTGG + Intronic
1153618871 18:6957618-6957640 AGGTGTTCCTGGGCAGATGCTGG + Intronic
1153765445 18:8370125-8370147 ACGTGTTCCTGCCCAGCCTCTGG + Intronic
1154141958 18:11831869-11831891 AGGTGGCACTGAGCAGCTGCAGG + Intronic
1161811730 19:6475379-6475401 AGGTGTCCCTGCTGAGGCTCCGG - Exonic
1162567447 19:11451975-11451997 AGGGGTCCCTGCCCTGCTGCAGG + Exonic
1162913279 19:13861535-13861557 AAGTGTCCCTGCCCAGACTCTGG + Intergenic
1163591208 19:18195041-18195063 ACGTGTCCCAGCCCAGCGTCAGG - Exonic
1165341534 19:35215684-35215706 AGGTGTCCTTCAGCAGCTCCAGG - Intergenic
1165888925 19:39099087-39099109 GGGTGTCCCTGCGCAGCCGGGGG - Exonic
1168300061 19:55399642-55399664 ATGGGCCCCTGCGTAGCTTCAGG - Intronic
925346897 2:3178087-3178109 AGGTTTTCCTGCTCAGCTGCTGG - Intergenic
926182741 2:10660178-10660200 AGGTGCCCCAGCGCAGTTACAGG - Intronic
926222238 2:10943791-10943813 ATGTGTCCCTGTGCAACTTAAGG - Intergenic
930430051 2:51264446-51264468 AGATGTCCCTGAGTATCTTCTGG - Intergenic
931264283 2:60646698-60646720 AGCTGCCCCTGCACATCTTCAGG + Intergenic
932282439 2:70505653-70505675 AGTTGTCACTTAGCAGCTTCAGG - Intronic
932340495 2:70960215-70960237 AGCTGTCCCTGGGCAGCTCAGGG + Intronic
933063480 2:77767686-77767708 AGGTGCCTCCTCGCAGCTTCAGG - Intergenic
934149227 2:89129458-89129480 AAGGGTCCCTGCTCAGCTCCTGG - Intergenic
935615856 2:105081066-105081088 AGGGGTCCCCGGGCAGCCTCAGG - Intronic
937907614 2:127059877-127059899 AGGCGTCTCTGTGCAGGTTCTGG - Intronic
946777553 2:223159143-223159165 AGGGCTCCCTGGGAAGCTTCAGG + Intronic
1168979672 20:1993921-1993943 CTTTGTCCCTGGGCAGCTTCTGG + Exonic
1169268528 20:4182126-4182148 AGGTGTCCCTGAGCGCCTTCGGG + Exonic
1176156965 20:63626859-63626881 AGGGGTCCCTGCGGAGCGTCAGG - Intronic
1180226924 21:46399246-46399268 AGGTCTCCCTGTGCAGCCTGTGG + Intronic
1180226938 21:46399323-46399345 AGGTCTCCCTGTGCAGCCTGTGG + Intronic
1180235183 21:46454729-46454751 AGGATTCCATGCCCAGCTTCTGG - Intergenic
1181749049 22:24976367-24976389 TTGTGTCCCTGCTCAGCTCCTGG - Intronic
1182053560 22:27331736-27331758 GGGTCTCCCTTGGCAGCTTCTGG - Intergenic
1182076349 22:27498064-27498086 AGGGGCCACTGCGCAGCTTCAGG - Intergenic
1182983810 22:34698078-34698100 AGTTGTCCCTGCCCAGGTACAGG + Intergenic
1183656375 22:39187510-39187532 ACCTGGCCCTGCTCAGCTTCTGG - Intergenic
1184241425 22:43212972-43212994 AGGAGCACCTGCTCAGCTTCAGG + Intronic
1185057274 22:48587607-48587629 AGGTGTCCCTGGGACACTTCAGG - Intronic
950493195 3:13318611-13318633 TGGTGACCCTGCACAGCTCCAGG - Intronic
950501033 3:13363952-13363974 GGGTTGCCCTGCGCACCTTCTGG - Intronic
951413279 3:22391417-22391439 TGGTGTTCCTGAGCATCTTCTGG - Intergenic
956798824 3:72738950-72738972 AGGAGGCCCTGCGCGGCTCCGGG + Intergenic
966739138 3:183215782-183215804 AGCTGTCCCTTGGCATCTTCAGG - Intronic
967198415 3:187049549-187049571 AGGTGTCCCTCCTCAGCTCAGGG + Intronic
967896093 3:194397161-194397183 AGGTGTCCCTGCGCCGCAACAGG - Exonic
972824403 4:42740078-42740100 AGGTGTCCCTTCTCAGTTTTTGG - Intergenic
973576861 4:52298319-52298341 AGGTGTCCCTGCTCTGCTTATGG - Intergenic
974016729 4:56655600-56655622 AGGGGTTTCTGCGCAGCTCCCGG + Intronic
976316797 4:83667111-83667133 TTGTGTCCCTGCTCAGCTTGTGG - Intergenic
977290057 4:95155315-95155337 AGGTGGCCTTTTGCAGCTTCAGG + Exonic
980358217 4:131741952-131741974 AGGCATCCCAACGCAGCTTCCGG - Intergenic
984724700 4:183009571-183009593 AGGTGTCCCCGAGCTGCTTAGGG + Intergenic
986223129 5:5788278-5788300 CGGTGGCCCAGCCCAGCTTCTGG + Intergenic
995965476 5:117902454-117902476 AGGTGTGCTTCCGCAGATTCGGG - Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
999200315 5:149811802-149811824 AGGTGTCCCAGGGCAGTGTCAGG + Intronic
1001681696 5:173562669-173562691 AGGTTTCCCTGCCCATCTTAAGG - Intergenic
1002363223 5:178690010-178690032 AGGTGTCCCTGGCCAGCTGAAGG - Intergenic
1007482559 6:42159617-42159639 AGGCTGCCCTGCACAGCTTCCGG - Intronic
1011054727 6:83193268-83193290 ACGTGGCCCTGCGTGGCTTCCGG + Intronic
1014795518 6:125719887-125719909 AGGGGTCCCTGATTAGCTTCAGG - Intergenic
1015843362 6:137495368-137495390 AGGAGGCCCGGCGGAGCTTCGGG - Intergenic
1019312378 7:369124-369146 ACGTGTCCCTTCACAGCCTCTGG - Intergenic
1020257546 7:6510500-6510522 AGGCGTCCCTGTGCTGCTTCAGG - Intronic
1032198327 7:129802220-129802242 TGGTGTCCCAGCCCAGCCTCTGG + Intergenic
1034451143 7:151137971-151137993 CAGGGTCCCTGCGCAGCCTCTGG + Intronic
1034589553 7:152128222-152128244 AGGCGCCCCTGGGCAGGTTCTGG - Intergenic
1035016724 7:155773243-155773265 AGGTGTCCCTGGGCAGGTCCTGG - Intronic
1035362939 7:158325249-158325271 AGGTGTCCCTGCCCAGGAGCTGG - Intronic
1041876366 8:62691930-62691952 ATGTGTCCATGGCCAGCTTCAGG + Intronic
1045328498 8:101135239-101135261 ATGTGGCCCTGCAGAGCTTCGGG - Intergenic
1049039120 8:140099117-140099139 AGGTCTCAGTGCGCAGCTGCAGG + Intronic
1049039194 8:140099576-140099598 AGGTCTCAGTGCGCAGCTGCAGG + Intronic
1052781197 9:32783333-32783355 AGGTCGCCCTGCTCAGCCTCCGG + Intergenic
1057699202 9:97350468-97350490 AGGTGTCCCTGCGCAGCTTCCGG + Exonic
1058066470 9:100554141-100554163 AGGTATCCCTGGCCAGCTGCAGG - Intronic
1059451035 9:114371651-114371673 AGGTATCCCACCCCAGCTTCAGG - Intronic
1059460158 9:114424493-114424515 AGGTGACCCTGAGCAGCCTGGGG - Exonic
1061402629 9:130376667-130376689 GGGACCCCCTGCGCAGCTTCTGG + Intronic
1061841032 9:133358703-133358725 AGGTGTCCCTGCCAAGCTTCAGG - Intronic
1062538551 9:137031537-137031559 AGGTGTCGCTGGGCAGCTCTGGG + Exonic
1192495285 X:71612476-71612498 GGGTGACCCTGGGCAGCTCCGGG - Exonic
1195620011 X:106943411-106943433 AGGTGTGACTGGGCAGCATCTGG + Intronic
1197094324 X:122575007-122575029 CGTTTTCCCTGTGCAGCTTCAGG - Intergenic
1197759938 X:130020987-130021009 GGGGGTCACTGGGCAGCTTCCGG - Exonic
1198518492 X:137430192-137430214 AGGTGTCGCTGGGGAACTTCAGG - Intergenic
1201244193 Y:11986883-11986905 AAATGTCCCTGCCCAGCTGCAGG - Intergenic