ID: 1057700967

View in Genome Browser
Species Human (GRCh38)
Location 9:97362783-97362805
Sequence CCACATGCATATTTTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057700956_1057700967 22 Left 1057700956 9:97362738-97362760 CCTGCCCACCAAGCCTCAGTGGG 0: 1
1: 0
2: 4
3: 37
4: 256
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data
1057700961_1057700967 14 Left 1057700961 9:97362746-97362768 CCAAGCCTCAGTGGGGTTGTTAG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data
1057700960_1057700967 17 Left 1057700960 9:97362743-97362765 CCACCAAGCCTCAGTGGGGTTGT 0: 1
1: 0
2: 0
3: 21
4: 172
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data
1057700954_1057700967 23 Left 1057700954 9:97362737-97362759 CCCTGCCCACCAAGCCTCAGTGG 0: 1
1: 0
2: 3
3: 31
4: 269
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data
1057700962_1057700967 9 Left 1057700962 9:97362751-97362773 CCTCAGTGGGGTTGTTAGACTCA 0: 1
1: 0
2: 2
3: 6
4: 98
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data
1057700959_1057700967 18 Left 1057700959 9:97362742-97362764 CCCACCAAGCCTCAGTGGGGTTG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057700967 Original CRISPR CCACATGCATATTTTATGGA AGG Intronic
No off target data available for this crispr