ID: 1057702992

View in Genome Browser
Species Human (GRCh38)
Location 9:97376993-97377015
Sequence CGGCACAGAGCAGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 4, 3: 121, 4: 571}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057702992_1057703004 30 Left 1057702992 9:97376993-97377015 CCCTCCACCCCTGCTCTGTGCCG 0: 1
1: 0
2: 4
3: 121
4: 571
Right 1057703004 9:97377046-97377068 CAGCATGGTCCCTGCCCACGTGG 0: 1
1: 0
2: 4
3: 45
4: 306
1057702992_1057703001 4 Left 1057702992 9:97376993-97377015 CCCTCCACCCCTGCTCTGTGCCG 0: 1
1: 0
2: 4
3: 121
4: 571
Right 1057703001 9:97377020-97377042 CTGTAGCTTTACCAGCGAACAGG 0: 1
1: 0
2: 0
3: 1
4: 51
1057702992_1057703003 15 Left 1057702992 9:97376993-97377015 CCCTCCACCCCTGCTCTGTGCCG 0: 1
1: 0
2: 4
3: 121
4: 571
Right 1057703003 9:97377031-97377053 CCAGCGAACAGGACACAGCATGG 0: 1
1: 1
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057702992 Original CRISPR CGGCACAGAGCAGGGGTGGA GGG (reversed) Intronic
900093458 1:930524-930546 CGCCGCAGAGCAGAGGTGGGAGG - Intronic
900094587 1:935039-935061 CGGAACCGGGAAGGGGTGGAGGG + Intronic
900180078 1:1307495-1307517 AGACACAGAGCGGGGGCGGACGG + Intronic
900467714 1:2833871-2833893 CAGCACAGTGCCGGGGTGCACGG - Intergenic
900586053 1:3432862-3432884 CAGCACAGGGCAGGTGGGGATGG - Intronic
900840629 1:5046050-5046072 AGACACAGAGAAGGGGTGGAGGG - Intergenic
900951770 1:5862070-5862092 CCCCACAGGGCAGGGCTGGATGG + Intergenic
901402824 1:9026025-9026047 CGGAGGGGAGCAGGGGTGGAAGG + Intronic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901769940 1:11524914-11524936 GGGCACAGAGATGGGGTGGCAGG - Intronic
901881954 1:12199261-12199283 AGGCTCAGAGCAGGGCTGGGGGG + Intronic
902399591 1:16150708-16150730 CGGCCCAGGCCAGGGCTGGATGG - Intronic
902597570 1:17520000-17520022 GGGTACAGGGCAGGGTTGGAGGG - Intergenic
902652166 1:17844118-17844140 CCCCACAGGGCAGGGGTTGAGGG + Intergenic
902831248 1:19014244-19014266 AGGCACAGGGCAGGGGAGGGCGG + Intergenic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
904003595 1:27351662-27351684 CACCACTGAGCAGGGGTGAAGGG + Intronic
904368694 1:30034902-30034924 CCACACATAGCAGGGGTGGGTGG - Intergenic
904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG + Intergenic
904505820 1:30952712-30952734 AGGAAGAGAGGAGGGGTGGAGGG + Intronic
904616357 1:31752336-31752358 CAGCACAGATCTGGGCTGGAAGG + Intronic
906833479 1:49059196-49059218 CTGCACAGAGCAGGGGTCCCTGG - Intronic
907410828 1:54282151-54282173 CGGTGCAGAGCAGGGGTGCATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908280859 1:62533489-62533511 TGGCGCCAAGCAGGGGTGGAAGG + Intronic
908326492 1:63028717-63028739 AGGCACAGAGGAGGGCTAGAGGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909495550 1:76273865-76273887 TGGCACAGAGTATGTGTGGAGGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912376602 1:109214337-109214359 CGGCACTGAGCACGCGTGGAAGG - Intronic
912701676 1:111882622-111882644 CGGCTCAGTGCAGGGGGCGAGGG + Intronic
914196166 1:145449099-145449121 GGGGACAAAGAAGGGGTGGATGG + Intergenic
915167781 1:153958227-153958249 CGGAACAGAGCAGGGGACGCGGG - Intronic
915366683 1:155320904-155320926 GGGCACAGAGCGGGAGGGGAGGG - Intronic
916124386 1:161556369-161556391 CGGTCCTGAGCAGGAGTGGAGGG + Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920563937 1:206959037-206959059 CAGCAGAGAGCAGGAGTGCAGGG - Intronic
920618003 1:207513470-207513492 AGGCACAGTGCAGGAGTAGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920829244 1:209450134-209450156 AGACACAGAGAAGGGGTGGGGGG - Intergenic
922048259 1:221967169-221967191 AGACACAGAGAAGGGGTGGGGGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924394727 1:243606827-243606849 CTGCACAGAGCCGGGTTGGGGGG - Intronic
924622248 1:245672265-245672287 GAGCAGGGAGCAGGGGTGGAAGG + Intronic
1062952460 10:1515237-1515259 CAGCACAGAGCAGGGGCAGGCGG + Intronic
1063060794 10:2550336-2550358 GGGCCCAGAGCAGGTGTGCACGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066244767 10:33571710-33571732 AGGCAAAGAGCAGGGGTGAGGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067413373 10:46084579-46084601 GGGCACAGAGCAGGGTGGGGAGG + Intergenic
1067569332 10:47360107-47360129 CAGCACAGAGCTGGGGGGCATGG + Intergenic
1068147385 10:53088788-53088810 CGCCACAGGCCTGGGGTGGAAGG - Intergenic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069798980 10:71070629-71070651 TGGCAGTGAGCAGGGGTGGTGGG - Intergenic
1069884520 10:71615450-71615472 AGGCACAGGGCAGGGGGGCATGG - Intronic
1069916519 10:71790214-71790236 CGGGACAGGGCAGGGGAGGTGGG + Intronic
1070604187 10:77887066-77887088 CTGCACAGAGCATGGGTAAATGG - Intronic
1070786724 10:79166361-79166383 CGCCAAAGAGCAGGGTGGGAGGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071486204 10:86104276-86104298 CTTCACAGAGCAGGCGTGGTTGG - Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072637905 10:97189069-97189091 GGGCACAGAGTGGGGCTGGAAGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073608067 10:104915502-104915524 CCACACAGAGCTGGGGTGGGGGG + Intronic
1074780410 10:116798191-116798213 GGGCAGGGAGCAGGGGTGGCAGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075095647 10:119468995-119469017 GGGAACAGAGCAAGGGGGGAGGG + Intergenic
1075100595 10:119503557-119503579 CTGCCCAGCGCAGGGCTGGAGGG - Intronic
1075222995 10:120600798-120600820 CAGCACAGAGCAGGGGGAGAAGG - Intergenic
1075582927 10:123635627-123635649 TGGCACAGAGCAGGTGTTCAGGG + Intergenic
1075683777 10:124350072-124350094 CGGGACAGTGCAGGGCTGGAGGG + Intergenic
1075914950 10:126158749-126158771 ATGCACAGAGCACGGGTGGGAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076731635 10:132442326-132442348 CAGCACAGAGCAGGGGCGCTGGG + Intergenic
1076864989 10:133162036-133162058 CGGCACAGTACTGGGGTGGGTGG + Intronic
1077307682 11:1875297-1875319 CTGCACAGATCAGGTCTGGAAGG - Intronic
1077409264 11:2395846-2395868 CTGCAGAGAGCAGGGGTGCAAGG - Intronic
1078150863 11:8758747-8758769 AGGCACAGCGCTGCGGTGGAGGG - Intronic
1078430371 11:11283517-11283539 GGGCACAGAGCATTGGAGGAAGG + Intronic
1078521769 11:12069304-12069326 CGGGACAGAGCAGTGGCTGATGG - Intergenic
1078541488 11:12217045-12217067 AAGCACGGAGCAGGGTTGGAAGG + Intronic
1079016032 11:16869517-16869539 CGGCACAGAGCATATGTGCAAGG + Intronic
1079652657 11:22949683-22949705 GAGGACAGAGAAGGGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081853594 11:46290451-46290473 CGGCAGAGGGCAGGGCTGGAAGG - Intronic
1081867552 11:46367832-46367854 CGGCCCACAGCAGGGGTGCCAGG - Intronic
1083315581 11:61813177-61813199 GGGGACAGAGAGGGGGTGGAAGG - Intronic
1083708267 11:64531330-64531352 GGGCACAGTGCGGGTGTGGAAGG + Intergenic
1084097303 11:66920147-66920169 TGGCACAGAGGAGGGGAGGAGGG + Intronic
1084213147 11:67633111-67633133 AGGGACAGAGCAGGGGTACAGGG + Intronic
1084278668 11:68071383-68071405 TGGCACAGAGCAGGTGTCCAGGG + Intronic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084466886 11:69328473-69328495 TGGCACAGAACAGGCGTGGCGGG + Intronic
1084472683 11:69372326-69372348 TGGTACAGATCTGGGGTGGAGGG + Intergenic
1084569175 11:69949269-69949291 GGGCACAGGGCTGGGGAGGAGGG + Intergenic
1084669361 11:70596201-70596223 CCCCACAGAGCAGGCGGGGAAGG - Intronic
1084766397 11:71311787-71311809 AAGCACAGAGCAGGTGTGGAGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085272573 11:75278917-75278939 TGGGACAGAACAGGGGAGGATGG - Intronic
1085523870 11:77153332-77153354 CTGGAGAGAGCAGGGTTGGAGGG + Intronic
1085529563 11:77183398-77183420 GGGCACTGAGCAGGGGAGGCCGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085777952 11:79383071-79383093 GGGCACAGAGCAGGGCAGAAAGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088922859 11:114274058-114274080 CAGCACTGAGCAGGGGTAGGAGG - Intronic
1089683845 11:120134496-120134518 TGGCACAGAGCAGGGTTAGTGGG - Intronic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1090234876 11:125139849-125139871 CTGCCCAAAGCAGGGGGGGAGGG - Intergenic
1090982132 11:131732414-131732436 CAGGACAGAGAAGGGGTAGAGGG - Intronic
1091120988 11:133057423-133057445 AGGCACAGAGCAGGACAGGAAGG - Intronic
1091403998 12:197630-197652 AGGCACAGAGGAGGGGAGGAAGG + Intronic
1091780809 12:3213520-3213542 CAGGAGAGAGCAAGGGTGGAGGG + Intronic
1091828680 12:3534105-3534127 GGGGACAGAGTAGGGGTGGCAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096123224 12:49102182-49102204 CTGCACAGAGAAGAGGCGGAAGG - Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096459394 12:51814092-51814114 CGCCACAGTGCAGGGCTGGTGGG - Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1096842962 12:54390473-54390495 CGGCCCAAGGCAGGGGTGGAGGG + Intronic
1097075102 12:56387203-56387225 CAGCACACAGCAAGAGTGGAAGG + Intergenic
1097262732 12:57728626-57728648 CGGCAGAGAGCAGGGGCAGCAGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098462787 12:70751324-70751346 TGGCATAGAACAGGGGTGGGTGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101959412 12:109237431-109237453 CAGCACAGAGCAGGAATGTAAGG - Intronic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104270864 12:127281005-127281027 GGGCACTGGGCAGGGCTGGAGGG + Intergenic
1104555774 12:129798691-129798713 CAGAAGAGAGAAGGGGTGGAGGG + Intronic
1104555784 12:129798743-129798765 TGGCTTAGAGAAGGGGTGGAGGG + Intronic
1104558342 12:129822196-129822218 GGGCACTGAGCAGGGCTGGAGGG + Intronic
1104689731 12:130816354-130816376 CGTTACACAGCAGGGGTGGGGGG + Intronic
1105514304 13:21076423-21076445 TCGCACAGTGCAGGGGCGGAGGG + Intergenic
1106909487 13:34448190-34448212 AGCCACAGAGCAGGAGTTGATGG - Intergenic
1108266083 13:48710288-48710310 CTGCCCAGAACATGGGTGGAGGG - Exonic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110236367 13:73221684-73221706 AGGCACTTAGCAGGTGTGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111339241 13:86862412-86862434 CTGCACAGAGCAGGGGGGCCTGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113755617 13:112808811-112808833 CTGCACATAGCAGGGGAGGCTGG - Intronic
1114075117 14:19157705-19157727 GGGCCCAGCGCAGGGGTTGATGG - Intergenic
1114087152 14:19242277-19242299 GGGCCCAGCGCAGGGGTTGATGG + Intergenic
1114233425 14:20803469-20803491 GCCCCCAGAGCAGGGGTGGAGGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115240750 14:31249802-31249824 CAACACAGAGAAGGGGTGGGGGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117408420 14:55427660-55427682 CCTCAGAGAGCAGGGATGGAGGG - Intronic
1118780800 14:69006368-69006390 AGACACAGAGGATGGGTGGAGGG - Intergenic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119162600 14:72465518-72465540 GGGCACATAGCAAGGGTGGGTGG + Intronic
1119781040 14:77277112-77277134 GTGCACAGCGCAGGGGAGGATGG - Exonic
1119946992 14:78705393-78705415 CTGCACAGAGCAGGTGGGGAAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121104379 14:91271066-91271088 GGGCGCAGAGGGGGGGTGGAGGG + Intergenic
1121332848 14:93059348-93059370 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121332920 14:93059571-93059593 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121813336 14:96910761-96910783 AGGCACAGAGCAGGTATGGAGGG + Intronic
1121813350 14:96910832-96910854 GGGCACAGAGCAGGTATGGAGGG + Intronic
1121827502 14:97022491-97022513 GGGCACTGAGCAGGGGGAGAAGG - Intergenic
1122325752 14:100879931-100879953 CTGGACAGTGCAGGGGTGCAGGG - Intergenic
1122366680 14:101198584-101198606 GGGCACAGAGGAGCGGAGGAAGG - Intergenic
1122997191 14:105271648-105271670 CAGCACAGAGCAGAGGAGGCTGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123161540 14:106282945-106282967 GGGCACAGAAGAGGGGAGGAGGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124018454 15:25898387-25898409 AGGCAAAGAGCAGGAGTGGTGGG + Intergenic
1124222584 15:27863164-27863186 AGGCACAGAGCAGCGGTGGGAGG + Intronic
1125182150 15:36888994-36889016 TGGAAGAGAGGAGGGGTGGACGG + Intergenic
1125730261 15:41889018-41889040 CAGCAGGGAGCAGGGCTGGAGGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128924056 15:71637681-71637703 GGGTACAGAGTAGAGGTGGATGG + Intronic
1129519644 15:76177754-76177776 CAGCACAGAGCAGCTCTGGACGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132290310 15:100696117-100696139 CTGAACAGAGCAGGAGAGGATGG - Intergenic
1132457092 16:29934-29956 TGGAACAGAGCACGGGAGGAGGG + Intergenic
1132500552 16:282924-282946 CGGGACAGAGCAGGGGCAGCAGG - Exonic
1132764525 16:1527444-1527466 GGGCACAGGGCTGGGGTGGAAGG - Intronic
1132827853 16:1913922-1913944 CGGTGCAGAGTAGGGGTGGGCGG + Intronic
1133073426 16:3262041-3262063 AGGCACGGAGGAGGAGTGGATGG + Intergenic
1134251722 16:12578770-12578792 TGGCATGGAGCAGGGGTGGTAGG - Intergenic
1134342338 16:13357076-13357098 AGACACGGAGAAGGGGTGGAGGG + Intergenic
1135414530 16:22258568-22258590 GGGGACGGAGCAGGGGTGGCCGG - Exonic
1135424250 16:22324490-22324512 CGGCGCAGAGCTGGAGGGGAGGG - Exonic
1135985556 16:27181221-27181243 CAGCAGAGAGCAGGGATAGAGGG + Intergenic
1136036483 16:27544433-27544455 TGGAAAAGAGCAGGGGTAGAGGG + Intronic
1136072596 16:27796983-27797005 TGGCACACAGCAGGAGTGGGAGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136390833 16:29963191-29963213 TGGCACAGACCAGAGGTGGGTGG - Exonic
1136777729 16:32880656-32880678 CGGGACAGGGCACGGGTGGCAGG + Intergenic
1136892894 16:33980858-33980880 CGGGACAGGGCACGGGTGGCAGG - Intergenic
1138282496 16:55782679-55782701 AGGCACAGAGCAGGGGAAGCTGG + Intergenic
1138527290 16:57616447-57616469 GGGCACATAGGAGGTGTGGAGGG - Intronic
1138549936 16:57741942-57741964 GGGCCCAGCTCAGGGGTGGAGGG + Intronic
1139226070 16:65234333-65234355 AGACACGGAGAAGGGGTGGAGGG + Intergenic
1139254637 16:65529169-65529191 GGGCACTGAGCAGGGGCTGAGGG - Intergenic
1139480818 16:67229723-67229745 AGGGACAGAGCAGGGTTGGAGGG + Intronic
1139661805 16:68425863-68425885 CGGCATAGTGCAAGGGAGGAGGG - Intronic
1139805983 16:69565927-69565949 GGGCACAGCGCAGGCGCGGAGGG - Intronic
1139943199 16:70620956-70620978 AGACACGGAGAAGGGGTGGAGGG + Intronic
1139958193 16:70703315-70703337 AGGCAGAGAGCTGGGGTGGGAGG + Intronic
1140134952 16:72197680-72197702 AGCCACAAAGAAGGGGTGGAGGG - Intergenic
1141539577 16:84709385-84709407 GGGCACAGAGCTGGAGGGGAGGG + Intronic
1141673397 16:85504796-85504818 GGGTACAGAGCTAGGGTGGATGG + Intergenic
1141697875 16:85628610-85628632 AGCCACAGGGCAGAGGTGGAGGG - Intronic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1141987840 16:87591346-87591368 GGGCACGGAGCAGAGGAGGATGG + Intergenic
1142112872 16:88341490-88341512 CGTCAGAGAGCTGGGGAGGACGG - Intergenic
1142209799 16:88803693-88803715 CGGGGCAGAGCACGGGGGGAGGG - Exonic
1142212738 16:88816215-88816237 GGGCACAGGGCAGGGGAGGTGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203080145 16_KI270728v1_random:1142765-1142787 CGGGACAGGGCACGGGTGGCAGG + Intergenic
1142508985 17:382836-382858 CTGCACAGAGAAGGGAAGGACGG + Intronic
1142598067 17:1039247-1039269 CGGCACTTCCCAGGGGTGGAGGG + Intronic
1143312433 17:6003067-6003089 GAGCACAGAGGAGGGGTGCAGGG + Intronic
1143447945 17:7019837-7019859 CGGGACAGAGCAGGGCTGGCGGG - Intergenic
1143927721 17:10387325-10387347 GGGCACAAAGAAAGGGTGGAGGG - Intergenic
1145997162 17:29111387-29111409 GGGTACAGAACAGGGGCGGAGGG + Intronic
1146642876 17:34554434-34554456 TGACACAGACCAGGGGAGGAGGG - Intergenic
1146938203 17:36825685-36825707 AGGCACAGCGCGGGGGTGGGGGG + Intergenic
1147464362 17:40599351-40599373 CGTCACAGAGCAGGGGAGAAAGG + Intergenic
1147649109 17:42051824-42051846 TGGCACAGAGCAGTGCTGCATGG - Intronic
1148028906 17:44606775-44606797 CGGGACAGGGGCGGGGTGGAGGG - Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148462187 17:47845220-47845242 TGGCACAGGGAAGGGGTGGCTGG + Exonic
1148500393 17:48086217-48086239 CTCCTCAGTGCAGGGGTGGAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149373534 17:56020687-56020709 ATGAACATAGCAGGGGTGGATGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151405734 17:73884975-73884997 TGACACAGAGCAGGGTGGGAAGG + Intergenic
1151584885 17:75003000-75003022 GGGCAGAGAGCAGGGGGAGAAGG + Intronic
1151899568 17:77002758-77002780 ATGCACAGAGGAGGGGTGGCTGG + Intergenic
1151938978 17:77281245-77281267 CAGCGCAGCGCAGGGGTGGGCGG + Intronic
1152009143 17:77700226-77700248 GGGAGAAGAGCAGGGGTGGACGG + Intergenic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152581879 17:81169092-81169114 CGGGACAGAGCACAGGTGGAGGG + Intergenic
1152697152 17:81803196-81803218 GGGCACAGAGCAGGGATGGCTGG + Intergenic
1203162158 17_GL000205v2_random:62784-62806 GGACCCAGAGCAGGGGTTGAAGG + Intergenic
1153070094 18:1095692-1095714 GGAGACAGAGCAGGGGAGGAAGG + Intergenic
1153326598 18:3826880-3826902 CAGGGCAGAGCAGCGGTGGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153893116 18:9536396-9536418 CTGCACCGAGAAGGTGTGGAAGG - Exonic
1154086514 18:11310630-11310652 AGGCAGAGGGCAGGGGTGGATGG + Intergenic
1154270284 18:12912424-12912446 CGGCACAGCGCAGGGGTGGGAGG - Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156257044 18:35408807-35408829 CAGCACACAGCAGGCATGGAGGG - Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1156395199 18:36693079-36693101 CAGCACAGTGCAGGGCTGGCTGG - Intronic
1156752433 18:40475380-40475402 CAGCACAGAGGAAAGGTGGAAGG + Intergenic
1157112544 18:44834560-44834582 AGGCACAGAGCAGGAGAAGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157332916 18:46716525-46716547 TGGCAAAGAGGAGGTGTGGAAGG - Intronic
1157539440 18:48489406-48489428 CAGAATAGAGCAGGAGTGGAAGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159856568 18:73596459-73596481 AGGCACAGAGCAGGGCAGAAAGG + Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160420868 18:78742949-78742971 CACCTCAGAGCAGGGGTGGAGGG - Intergenic
1160855131 19:1213849-1213871 CGGCTCAGAGCAGGACTGGGAGG - Intronic
1161159793 19:2755458-2755480 AGGCACAGGGCCGGGGTGGCCGG + Exonic
1161551697 19:4916593-4916615 CAGCACACAGGACGGGTGGAGGG - Intronic
1161571141 19:5031474-5031496 CTGCACAGAGCAAGGGTGGCGGG + Intronic
1161719712 19:5896066-5896088 CGGCACAGAGCGAGGGCGGCGGG + Intronic
1162030847 19:7916659-7916681 CGTCACTGAGCAGCGGTGCAGGG - Exonic
1162796859 19:13091640-13091662 TGGCACAGAGCAGAGGGGGCTGG - Intronic
1162907938 19:13834384-13834406 CTGCACAGAGCAGGTGGGGCAGG + Intergenic
1162968010 19:14164929-14164951 GGGCACAGGGCGAGGGTGGAGGG + Intronic
1163302530 19:16457028-16457050 CTGCAAGGAGCAGGGCTGGAAGG + Intronic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1163906882 19:20155779-20155801 AGACACGGAGAAGGGGTGGAGGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165095394 19:33407220-33407242 CCCCACAGGGCAGAGGTGGAGGG - Intronic
1166509521 19:43395519-43395541 TGGCACAGAGCAGGGGCTCAGGG - Intergenic
1166642078 19:44501596-44501618 AGGCACAGAGCATGTGGGGAGGG - Intergenic
1166819323 19:45567514-45567536 GGAGACAGAGCAGGGGAGGAGGG + Intronic
1167160721 19:47765759-47765781 GGGCACTGAGCAGAGGTGGCGGG + Intergenic
1167210766 19:48132919-48132941 CGTCAAAGAGCAGGGGTGTGGGG - Intronic
1167445225 19:49533646-49533668 CAGCACAGGGCAGGGCTGGAGGG + Intronic
1167486693 19:49767075-49767097 GGGCACAGAGCAGCGGGGGCTGG - Intronic
1167607598 19:50489721-50489743 AGGAACAGAGCAGCTGTGGAAGG + Exonic
1167618808 19:50550204-50550226 GGGCACAGAGCAGGCCGGGAGGG + Intronic
1167703562 19:51065334-51065356 CGCCAGAGGGCAGGGGAGGAGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168427865 19:56253320-56253342 GGGCAGGGAGGAGGGGTGGAGGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925365049 2:3305562-3305584 GGGCACAGGACAGGAGTGGAGGG - Intronic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
926125116 2:10267246-10267268 CGGAACAGAGCAGGGTTCCAAGG - Intergenic
926682899 2:15677450-15677472 CTGCCCAGAGCAGGGGAGGCTGG + Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928910728 2:36418219-36418241 AGGCACAGTGCAGGAGTGCAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931181847 2:59909437-59909459 ATGCACAGGGCAGGGGTGGGTGG + Intergenic
931236786 2:60418842-60418864 AGACACAGAGAAGGGGTGGGGGG - Intergenic
932132072 2:69196952-69196974 CAGCACAGAGCAGGGGCTCAGGG + Intronic
932592807 2:73077215-73077237 CAGCACAGAGGAGGTGTGGCGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934039832 2:88118573-88118595 AGGCAGAGAGGAGGCGTGGAGGG + Intergenic
934559469 2:95305175-95305197 CGGCATCGAGCAGGAGTGGGAGG + Intronic
934735877 2:96689528-96689550 CTGCCCAGAGCAGGTGGGGATGG + Intergenic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
935118731 2:100161046-100161068 CAGCTCAGCTCAGGGGTGGAGGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936399346 2:112153879-112153901 CGGAGAAGGGCAGGGGTGGATGG + Intronic
936399498 2:112154753-112154775 TGGCTCAGAGCAGGGGAGGGTGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937241050 2:120462968-120462990 AGCCACAGAGCAGGGGTGTGGGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
938263863 2:129912668-129912690 GGGCACAGAGGAGGGGCTGAGGG + Intergenic
938754664 2:134368771-134368793 AGGTACAGAGCAGGAGTGGCTGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940675960 2:156724579-156724601 AGACACAGAGAAGGGGTGGGGGG + Intergenic
941456354 2:165715005-165715027 AGACACAGAGAAGGGGTGGAGGG + Intergenic
942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG + Exonic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944203743 2:197135755-197135777 AGGCACAGAGCAGGGGAGCAGGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945284059 2:208064778-208064800 GGACACAGAGCAGGTGAGGAAGG + Intergenic
946168926 2:217882259-217882281 TGGAACAGACCAGGGGTGGAAGG + Intronic
946176248 2:217923374-217923396 TGGCACAGAGCAAGGGTGATGGG - Intronic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
948066857 2:235087507-235087529 CAGCCCGGAGCAGGTGTGGAGGG - Intergenic
948301917 2:236914028-236914050 CAGGGCAGAGCAGGGGTGGATGG + Intergenic
948621335 2:239236564-239236586 CCGGACAGGGCAGGGGTGGGCGG + Intronic
948718788 2:239883209-239883231 AGTCACAGAGCTGGGGAGGAGGG - Intergenic
948803471 2:240443138-240443160 CGTCACAGAACTGGGGTGGGGGG + Intronic
948888786 2:240896937-240896959 CGGCCCTGAGCAGGGGAGGGGGG - Intergenic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
948988336 2:241539708-241539730 AGGCCCAGAGCAGGGGTGGCTGG - Intergenic
1168836589 20:881691-881713 TGGCACAGAGAAGGTGGGGAAGG + Intronic
1169155094 20:3323001-3323023 GCGCTCAGAGCAGGGATGGAGGG - Intronic
1170736258 20:19016255-19016277 GGGGACAGAGCTGGGGAGGATGG + Intergenic
1171448966 20:25223017-25223039 CGGCAGGGGGCGGGGGTGGAGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173185402 20:40836489-40836511 CCTCACAGAGCAGGAGTTGAGGG + Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1174048194 20:47748569-47748591 GGACAGAGAGCAGGGCTGGAAGG - Intronic
1174653683 20:52152166-52152188 CGGGACAGAGCAAAGCTGGATGG + Exonic
1174655058 20:52164645-52164667 TAGCACAGAGCAGGTGTTGAGGG + Intronic
1175283490 20:57820984-57821006 TTGCAGAGGGCAGGGGTGGAAGG + Intergenic
1175791998 20:61745707-61745729 CGGCACAGCTCAGGGAGGGAAGG - Intronic
1175890556 20:62314045-62314067 GGGCACAGACGAGGGGTGGCGGG + Intronic
1175970976 20:62686779-62686801 CACCACAGAGAAGGGGTGGCTGG + Intergenic
1176038743 20:63053194-63053216 GGGCCCAGAGCGGGGCTGGAGGG - Intergenic
1176058443 20:63161137-63161159 CGGGACAGAGCAGCAATGGAGGG - Intergenic
1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG + Intergenic
1176389445 21:6156047-6156069 TGGCCCAGAGCTGGGGTGCAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178704802 21:34864414-34864436 GGACCCAGTGCAGGGGTGGAAGG + Intronic
1178819682 21:35963688-35963710 CGGGACAGGGCAGGTGGGGAGGG + Intronic
1178976437 21:37224995-37225017 CAGAATAGAGTAGGGGTGGAGGG + Exonic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179734024 21:43382191-43382213 TGGCCCAGAGCTGGGGTGCAGGG - Intergenic
1179971480 21:44838421-44838443 ATGCACAGAGCAGGGCTGGAGGG + Intergenic
1180135004 21:45856592-45856614 CGGGGCAGAGCGGGGGTGGGGGG - Intronic
1180290766 22:10850614-10850636 GGGCCCAGCGCAGGGGTTGATGG - Intergenic
1180493567 22:15880041-15880063 GGGCCCAGCGCAGGGGTTGATGG - Intergenic
1180636830 22:17268567-17268589 AGCCCCAGGGCAGGGGTGGAGGG + Intergenic
1180885361 22:19239707-19239729 AGGCAGAGAGCAGAGTTGGAAGG - Intronic
1181141172 22:20806032-20806054 CAACACACAGCAGGGGTGGTGGG + Intronic
1181311997 22:21949941-21949963 GTGCTCAGAGCAGGGGCGGATGG - Intronic
1181524396 22:23471644-23471666 AAACACAGAGCAGGGGTGGGGGG + Intergenic
1181568420 22:23753235-23753257 CTTCACAGGGCAGGGGTGGGAGG - Intronic
1182098563 22:27642154-27642176 AGGAACACAGCAGGGGTCGAGGG + Intergenic
1182614154 22:31575124-31575146 TGGCAGAGAGCAGGGGTTCAAGG - Intronic
1183154878 22:36067061-36067083 CAGCACAGTGCGGGGGTGGGTGG - Intergenic
1183319584 22:37156911-37156933 CAGCACCGAGCAGGGGTGGGCGG - Intronic
1184507651 22:44914017-44914039 GGGAAGAGAGGAGGGGTGGAGGG + Exonic
1184642491 22:45879825-45879847 GGTCACAGAGCAGGGGTCCAGGG - Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
1185110226 22:48896453-48896475 GGGGACAGGGCAGGGGTGGGAGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950926342 3:16745517-16745539 AGACACGGAGAAGGGGTGGAGGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951678882 3:25273943-25273965 GTGCACAGTGCAGGGGTGGCAGG - Intronic
952096705 3:29962445-29962467 CGGCACTGAGGTGGGGTGTATGG + Intronic
952342015 3:32454927-32454949 ACACACAGAGCACGGGTGGAGGG - Exonic
952893782 3:38062920-38062942 CAGAACAGAGCAGGGCTGCAGGG + Intronic
952901960 3:38116654-38116676 CATCAGTGAGCAGGGGTGGAGGG + Exonic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953891867 3:46756768-46756790 CCTCACTGAGCAGGGGTTGAAGG + Intronic
953904024 3:46859242-46859264 GGGGACAGAGCAGGGCAGGAAGG - Intronic
954233188 3:49234697-49234719 AGGAACAGAGCAGGGCTGAAGGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955977048 3:64489529-64489551 CGGCAAGGAGCAGGAGTGCAGGG + Intergenic
956710482 3:72034900-72034922 CAGAGCAGAGCAGGGGTGGGTGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961386079 3:126524200-126524222 CGGCGCAGGGCAGGGGAGCACGG - Intergenic
961452533 3:127008867-127008889 GGGCACAGGACAGCGGTGGAGGG + Intronic
961471890 3:127120302-127120324 TGGCACAGAGAAGCTGTGGAAGG + Intergenic
961664111 3:128485836-128485858 CGGCACATAGGAGGGGTAGGTGG + Exonic
962660474 3:137596658-137596680 AGACACAGAGAAGGGGTGGAGGG - Intergenic
962795358 3:138845196-138845218 AGGCAAAGAGCAGGAGAGGAAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964714345 3:159706104-159706126 CTACACATAGCATGGGTGGAGGG + Intronic
965153107 3:165008309-165008331 AGGCTCAGGGCAGGAGTGGAGGG - Intronic
965262814 3:166505325-166505347 AGACACAGAGAAGGGGTGGGGGG + Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967743990 3:193034110-193034132 TGTCTCAGAGCAGGGGTGCAAGG + Intergenic
968044325 3:195615362-195615384 GGGCACGGAGCGGGGGTGCAGGG + Intergenic
968060110 3:195721421-195721443 GGGCACGGAGCGGGGGTGCAGGG + Intronic
968121282 3:196127880-196127902 AAGCACAGAGCAGGGGTGTCAGG - Intergenic
968283087 3:197491811-197491833 AGGCACAGGGTAAGGGTGGAGGG + Intergenic
968646138 4:1741522-1741544 CTGCCCAGAGCAGGCCTGGAAGG + Intronic
968775502 4:2537179-2537201 CGGCAGCGGGCAGGGGTCGATGG + Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
968949334 4:3682434-3682456 CGTCACAGATGAAGGGTGGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969293833 4:6257512-6257534 CTGCATTGAGCAGGGGTGGGAGG + Intergenic
969423164 4:7108902-7108924 GGGCAGAGAGGAGGGGTGGGTGG - Intergenic
969619250 4:8270667-8270689 CCGGACAGAGCAGGGGTCCAAGG - Intronic
969656933 4:8504028-8504050 CAGGAGAGAGCAGGTGTGGACGG - Intergenic
969721132 4:8893547-8893569 CTGCACCGAGCAGAGGTGTAAGG - Intergenic
969979303 4:11138213-11138235 GGGCACAGAGCACAAGTGGAGGG + Intergenic
970049255 4:11895163-11895185 CATCGCAGAGCAGTGGTGGAAGG - Intergenic
970530194 4:16974022-16974044 ATGCACAGAGCTGGAGTGGAAGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
971440418 4:26679244-26679266 CTGCACAGAGCAGGGGGGCCCGG - Intronic
971845759 4:31916205-31916227 CTGCACAGAGCAGGGGTCCCTGG - Intergenic
972619974 4:40738020-40738042 GGGCACAGAGCATTGGAGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973623422 4:52749502-52749524 CGGCCCAGAGTAAGTGTGGATGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976146033 4:82043872-82043894 CGGGACGGGGCAGGGGAGGAGGG - Intronic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976725582 4:88212809-88212831 AGGCACAGAGCAGGGGAGACAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978602451 4:110443220-110443242 GGGCACAGAGCAGGTGAAGAAGG - Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982069499 4:151683025-151683047 GGGTTCTGAGCAGGGGTGGAGGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983707522 4:170678675-170678697 AGACACAGAGAAGGGGTGGGGGG - Intergenic
984127211 4:175826307-175826329 CGCCACTGAGCAGGGGAGGAGGG - Intronic
985126353 4:186698651-186698673 CTGCACAGGGCAGGGGCTGAGGG + Intronic
985570237 5:640851-640873 CGGCACTGCCCAGTGGTGGAGGG - Intronic
985699383 5:1361332-1361354 GGACACAGGGCTGGGGTGGAGGG + Intergenic
986905622 5:12491048-12491070 TGACACAGAGAAGGGGTGGGGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988863506 5:35309026-35309048 CATCACACAGCAGGGATGGAAGG - Intergenic
988904323 5:35770713-35770735 AGCCACAGAGGAGAGGTGGAGGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992141930 5:73807170-73807192 CTGGACAGAGCAGGGGTGCAGGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992333050 5:75737396-75737418 GGGCACAGAGGAGAGATGGAGGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993524963 5:88954069-88954091 CAGCACAGAGGAGGGAGGGAGGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996849656 5:127937998-127938020 CAGCAGGGGGCAGGGGTGGAGGG - Intergenic
997453128 5:133999456-133999478 GGGCACAGAGCAGGGTGGAAGGG - Intronic
998207120 5:140165875-140165897 TGGGACTGAGCAGGGGTGGGCGG + Intergenic
998368492 5:141646202-141646224 AGGCAGAGAACAGGGGTGGGTGG + Intronic
998648481 5:144090836-144090858 CATCACAGATCAGGTGTGGAGGG + Intergenic
999133364 5:149301067-149301089 CAGCACAGACCAGGGGAAGAGGG - Intronic
999375006 5:151080847-151080869 CGGCCCGGAGCGGGGATGGAGGG - Intronic
1001679249 5:173544239-173544261 AGACACAGAGCAGGGCAGGAAGG - Intergenic
1001927348 5:175648102-175648124 GGGTACAGAGCAGGGGTAAAGGG + Intergenic
1002283680 5:178148355-178148377 TGGCTGAGGGCAGGGGTGGAAGG - Exonic
1002818596 6:701430-701452 CAGCACAGGGCAGGGCTGGCAGG - Intergenic
1002977004 6:2089847-2089869 CTACGCAGAGCAGGAGTGGAGGG - Intronic
1003182163 6:3801350-3801372 CGGCACACTGCAGGGCTGGCAGG - Intergenic
1003746252 6:9005739-9005761 TAGCACAGAGCAGGGGGAGATGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004513669 6:16303433-16303455 CTGGCCAGAGCAGGGCTGGAGGG - Exonic
1004615193 6:17281976-17281998 CAGGGCAGAGCAGGGGTGAAAGG + Intronic
1004834533 6:19516131-19516153 CTGCACAGAGCCGGGGTGGGGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006154960 6:32008997-32009019 CGGCTCAGAGCTGGGGTGGCTGG - Intergenic
1006161271 6:32041732-32041754 CGGCTCAGAGCTGGGGTGGCTGG - Intronic
1006373512 6:33659393-33659415 GGGCCCAGAGCAGGGCTGAAGGG - Intronic
1006591354 6:35160375-35160397 CGGCAGAGTGTAGGGGTTGAGGG - Intergenic
1006598278 6:35209279-35209301 GGGCAGAGAGGAGGGGTGGGAGG + Intergenic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1007102900 6:39262134-39262156 TGGCTCAGAGCAGAGGTGGATGG - Intergenic
1007239294 6:40413631-40413653 CAGCATGGAGAAGGGGTGGAAGG + Intronic
1007423720 6:41734487-41734509 CGGGACAGCCCAGGGGTGGGCGG + Intronic
1007529272 6:42526596-42526618 GGGCACAGAGCAGGGTGAGAGGG - Intergenic
1007625412 6:43243696-43243718 GGGCACAGAGCAGGTGAGGCGGG + Exonic
1007794182 6:44334323-44334345 AGGCACAGAGGAGGGGTGTGTGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010130619 6:72489159-72489181 TGACACAAAACAGGGGTGGAGGG - Intergenic
1010894692 6:81349609-81349631 AGACACAGAGAAGGGGTGGGGGG + Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013341872 6:109222848-109222870 TGTCACAGAGCAGGGGAGGTGGG - Intergenic
1013347602 6:109277214-109277236 GAGCACAGGACAGGGGTGGAAGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014405332 6:121043749-121043771 CGGCACACAGACGAGGTGGAAGG - Intergenic
1015298161 6:131623032-131623054 AAGCACAGAGCAGGGGTGTGTGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015985624 6:138881473-138881495 TTACACAGAGCAGGGGTGGGGGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018143933 6:160865435-160865457 CAGCACAAAGCTGGGGTGGGAGG - Intergenic
1019049972 6:169175166-169175188 AGCAGCAGAGCAGGGGTGGAAGG - Intergenic
1019478424 7:1255163-1255185 CGCCCCAGGGCAGGGGAGGAGGG - Intergenic
1019506477 7:1393918-1393940 AGGCAGAGGGCAGGGGTGCAGGG + Intergenic
1019603214 7:1895637-1895659 CGGCCCAGAGCAGGCATGGTGGG + Intronic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1019724666 7:2594808-2594830 CGGCACAGGGCAGGGTGGGGCGG - Intronic
1019911888 7:4105801-4105823 TTGCAGAGAGGAGGGGTGGAAGG + Intronic
1020677160 7:11196532-11196554 AGGCACAGAGCAGGTGAGCATGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885194 7:25130962-25130984 GGCCACAGAGCAGGGATTGAGGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022021116 7:26399780-26399802 TGGAACAGGGCAGGGATGGAGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023758769 7:43444647-43444669 CGACCCAGAGCCGGGCTGGAAGG + Exonic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024209996 7:47194854-47194876 CGTGACAGAGGAGGGATGGATGG + Intergenic
1024621179 7:51158917-51158939 AGGCACAGCGCGGGGGTGCAGGG + Intronic
1025017342 7:55449761-55449783 GGGCACAGTGCGGGGGTGGAGGG - Intronic
1025622356 7:63185694-63185716 GGGCACAGAGCAGGTGAAGAAGG - Intergenic
1026252648 7:68684369-68684391 CTGCTCAGAGTTGGGGTGGAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026979241 7:74516918-74516940 GGGCACAGAGGAGGGGAGGCAGG - Intronic
1026994384 7:74606228-74606250 CGGCCCAGGGCAGGGGCTGAGGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029082884 7:97988783-97988805 AGGCACAGAGGAGAGGAGGAGGG - Intronic
1029420535 7:100469627-100469649 CGCCAGAGTGCAGGGGTGCAAGG - Intronic
1030264862 7:107609453-107609475 GGTCACAGAGCTGGAGTGGAAGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031259386 7:119498202-119498224 AGCCAGAGAGCAGAGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031728089 7:125263417-125263439 AGACACAGAGAAGGGGTGGGGGG + Intergenic
1032089427 7:128903907-128903929 GGGCACAGGGCAGGGATGGAGGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032479344 7:132234064-132234086 TGGAGCAGAGCAGGAGTGGAGGG + Intronic
1033290718 7:140080517-140080539 CGGTAGAGAGCAGCGGAGGAGGG + Intergenic
1033607207 7:142936265-142936287 CTGCACAGAGCAGGTGTGCAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034268852 7:149793694-149793716 GGGCACTGAGCGGGGGTGGCTGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035090369 7:156305379-156305401 TGGCTCAGAGCAGGTTTGGATGG + Intergenic
1035365421 7:158346292-158346314 CGCCAGAGGCCAGGGGTGGAGGG - Intronic
1035685318 8:1519858-1519880 GGGCACAGAGCAGGGGAGCATGG + Intronic
1036489269 8:9210013-9210035 CTGCAGAAAGCAGGGATGGAAGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037765053 8:21767595-21767617 CAGCACAGAGCAGGGGCGTCCGG + Intronic
1038414805 8:27387119-27387141 AAGCTCAGATCAGGGGTGGAGGG + Intronic
1038765858 8:30427089-30427111 CGGCACACAGAAGGGGAGGTCGG - Intronic
1039079126 8:33718583-33718605 GGGAAGAGAGCAGGTGTGGAAGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039804345 8:40985718-40985740 AGGCACAGAGCAGAGGGGAAAGG + Intergenic
1040276311 8:46015841-46015863 CGACACAGAGCCTGGCTGGAAGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042058017 8:64787040-64787062 CTGCACAGAGCAGTGGGGCAGGG + Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046511926 8:115213444-115213466 AGACACGGAGAAGGGGTGGAGGG - Intergenic
1046656589 8:116901287-116901309 CAGGGCAGGGCAGGGGTGGAGGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048559288 8:135515497-135515519 GGGCACAGAGCAGAGTAGGAAGG - Intronic
1049101167 8:140580039-140580061 CGGAACAGAGCATGGGGGCAAGG + Intronic
1049307005 8:141909322-141909344 CGGCTCAGCGCAGAGGTAGACGG + Intergenic
1049358976 8:142202873-142202895 GGGCACAGAGCAGGGCAGGGAGG - Intergenic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1050650071 9:7766700-7766722 CGGGACAGAGCAGGGAAGTAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054992605 9:71346778-71346800 GGGAACAGAGTAGGGGTGGGAGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056768509 9:89460069-89460091 AGGCACAGAGCAGGCGTTGGTGG - Intronic
1056882817 9:90413771-90413793 AGACACAGAGAAGGGGTGGGGGG - Intergenic
1057528365 9:95822555-95822577 GGGCTCAGAGCAGGGGAGGGTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1057839514 9:98474496-98474518 CTACAGAGAGCAGGGGTGGATGG + Intronic
1058218329 9:102262826-102262848 AGGCGCAGAGCAGAGGAGGAGGG - Intergenic
1058621151 9:106884538-106884560 GGGGACAGGGCAGAGGTGGATGG - Intronic
1059410656 9:114130274-114130296 GGGCACAGAGAAGGGGACGAAGG - Intergenic
1059606865 9:115843716-115843738 AGACAGAGAGAAGGGGTGGAGGG + Intergenic
1059652306 9:116326204-116326226 AGGCAAAGAGCAGGTGTGGTTGG - Intronic
1059734623 9:117088843-117088865 CAGCACAGAGCTGGGCTGGGAGG + Intronic
1060180288 9:121529017-121529039 AGGCAGAGAGGAAGGGTGGAGGG + Intergenic
1061290789 9:129649340-129649362 CAGCCCAGAGCAGGGTGGGAAGG + Intergenic
1061329891 9:129885827-129885849 CGGCAGAGCGCAGCAGTGGAGGG - Intergenic
1061368077 9:130182823-130182845 AGGCACAGGGCAGGGCAGGATGG - Intronic
1061426542 9:130501954-130501976 GGGCACAGAGCAGGTGTAGAAGG + Intergenic
1061539615 9:131270968-131270990 AAGGACAGGGCAGGGGTGGAGGG - Intronic
1061582222 9:131545355-131545377 CGGCGCTGTGCAGGGCTGGAGGG - Intergenic
1061631512 9:131875059-131875081 CCCCACTGAGCAGGGGTGGCTGG - Intronic
1062083789 9:134638140-134638162 CGGCAGGGAGCAGGGAGGGAGGG + Intergenic
1062167443 9:135114966-135114988 TGCCATAGAGCAGGGGTGGGTGG - Intronic
1062445030 9:136590049-136590071 CGGCACAGGATGGGGGTGGATGG - Intergenic
1062698566 9:137887736-137887758 GGGGACAAAGAAGGGGTGGATGG - Intronic
1187557742 X:20368210-20368232 TTCCACAGACCAGGGGTGGAAGG - Intergenic
1187724000 X:22183279-22183301 GGGCAGAGAGCAGGGATGGCCGG - Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189830878 X:44971954-44971976 CGGCACAGAGAAGGGTTGCAGGG + Intronic
1190418008 X:50199892-50199914 GGGAATAGAGAAGGGGTGGAAGG - Intronic
1190678627 X:52804852-52804874 CTGCACAGAACAGCGGTCGAGGG + Intergenic
1190938646 X:55019275-55019297 GGGCACAGAGCAACAGTGGAAGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194507029 X:94745763-94745785 CTGCACACAGCAGGGGTGTGGGG - Intergenic
1194624602 X:96213513-96213535 CTGCACAGATCGGGGGTGGCGGG + Intergenic
1194893248 X:99406579-99406601 CTGCACAGAGCAGGGGTACCTGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196519782 X:116660389-116660411 AGGCACTGAGAATGGGTGGAAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198486991 X:137097294-137097316 TGGCACAAAGAAAGGGTGGAGGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200226619 X:154421035-154421057 CCGCACAGAGCTGGGGCTGAGGG + Exonic
1200399268 X:156009792-156009814 TGGAACAGAGCACGGGAGGAGGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic