ID: 1057705262

View in Genome Browser
Species Human (GRCh38)
Location 9:97391186-97391208
Sequence GTGAAGGCCCGGGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057705262_1057705269 3 Left 1057705262 9:97391186-97391208 CCTGCGCCGGCCCGGGCCTTCAC No data
Right 1057705269 9:97391212-97391234 CTGGTCTCTGCATCACATGGTGG No data
1057705262_1057705268 0 Left 1057705262 9:97391186-97391208 CCTGCGCCGGCCCGGGCCTTCAC No data
Right 1057705268 9:97391209-97391231 TCTCTGGTCTCTGCATCACATGG No data
1057705262_1057705271 14 Left 1057705262 9:97391186-97391208 CCTGCGCCGGCCCGGGCCTTCAC No data
Right 1057705271 9:97391223-97391245 ATCACATGGTGGTTCACTGAGGG No data
1057705262_1057705270 13 Left 1057705262 9:97391186-97391208 CCTGCGCCGGCCCGGGCCTTCAC No data
Right 1057705270 9:97391222-97391244 CATCACATGGTGGTTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057705262 Original CRISPR GTGAAGGCCCGGGCCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr