ID: 1057706029

View in Genome Browser
Species Human (GRCh38)
Location 9:97395831-97395853
Sequence GTGGCAGCCCAGATTTCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057706023_1057706029 4 Left 1057706023 9:97395804-97395826 CCTTACCAATTTGCAGGTGGAGG No data
Right 1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG No data
1057706026_1057706029 -1 Left 1057706026 9:97395809-97395831 CCAATTTGCAGGTGGAGGAGGAG No data
Right 1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG No data
1057706021_1057706029 7 Left 1057706021 9:97395801-97395823 CCACCTTACCAATTTGCAGGTGG No data
Right 1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057706029 Original CRISPR GTGGCAGCCCAGATTTCTGC GGG Intergenic
No off target data available for this crispr