ID: 1057706240

View in Genome Browser
Species Human (GRCh38)
Location 9:97396945-97396967
Sequence CTGGTAAGAAAAAGAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057706240_1057706243 -10 Left 1057706240 9:97396945-97396967 CCAACCCTTCTTTTTCTTACCAG No data
Right 1057706243 9:97396958-97396980 TTCTTACCAGTTCTGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057706240 Original CRISPR CTGGTAAGAAAAAGAAGGGT TGG (reversed) Intergenic
No off target data available for this crispr