ID: 1057708060

View in Genome Browser
Species Human (GRCh38)
Location 9:97412105-97412127
Sequence CCCAAGCCGCGGGGCGGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057708053_1057708060 10 Left 1057708053 9:97412072-97412094 CCGAGCAGGGCGGGGCGGGGGCT 0: 1
1: 1
2: 5
3: 61
4: 445
Right 1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG 0: 1
1: 0
2: 3
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057708060 Original CRISPR CCCAAGCCGCGGGGCGGCTC CGG Exonic
901797974 1:11691596-11691618 CCCCAGCCGAGGGGCAGCCCCGG - Exonic
901882462 1:12202251-12202273 CCCACCCTGCGGGGAGGCTCAGG - Intronic
903233749 1:21936978-21937000 CCCATGCCGCAGGGTGGCGCCGG + Intronic
903724720 1:25431560-25431582 CCCAGGCCACCGGGGGGCTCGGG - Intronic
903753625 1:25645807-25645829 GCCAAGAAGCAGGGCGGCTCTGG - Intronic
904676289 1:32201108-32201130 CCCAAGCCTCCGGTCGGCTGGGG - Intronic
905554735 1:38873229-38873251 AGCAAGCCGCTGGTCGGCTCTGG - Intronic
907276519 1:53319797-53319819 CCCAAGGGGCTGGGCTGCTCAGG + Intronic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
915911590 1:159918841-159918863 CACCAACCGCGGGGCGTCTCAGG - Exonic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
918793208 1:188857928-188857950 CCCACGCTGCGGGGAGGCTCGGG - Intergenic
919822171 1:201480531-201480553 CCCCAGCTGCGGGGCGGGGCGGG + Intergenic
919831023 1:201540018-201540040 CCCAAGCCTCGGGAGCGCTCAGG - Intergenic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
1064662211 10:17617426-17617448 CCCAAGGGGCGGGGCGGGGCGGG - Intergenic
1066660915 10:37737601-37737623 CCCATGCAGCGGGGAGGCTCAGG - Intergenic
1067477966 10:46578834-46578856 CCCAAGCCGCAGGGAGCCCCTGG + Intronic
1067616773 10:47762953-47762975 CCCAAGCCGCAGGGAGCCCCTGG - Intergenic
1067830551 10:49609318-49609340 TCCAAGCCCCGGGTGGGCTCTGG - Intronic
1068955977 10:62818831-62818853 CGCCAGTCGCGGGGCGGCCCGGG - Intronic
1069581845 10:69572053-69572075 CCCAAGACGGTGGGCGGCTCCGG + Exonic
1070873496 10:79779466-79779488 TCCAAGCGGCGGGACGTCTCGGG + Intergenic
1071055339 10:81503126-81503148 CCCAGGCGGCGGGGAGGCTCGGG - Intergenic
1071289992 10:84181795-84181817 CCCAAGCCCAGGGGCTGCCCAGG + Intronic
1073543253 10:104328930-104328952 CCTAAGCCGCAGGGGGACTCGGG - Intronic
1075031834 10:119029409-119029431 CCCGAGGCGCCGGGGGGCTCTGG + Intergenic
1077974916 11:7238009-7238031 CCAAAGCTGTGGGGCGGTTCTGG + Intergenic
1081573527 11:44305879-44305901 CCCGAGACGCGGGGCCGCTGCGG - Intronic
1082816999 11:57515536-57515558 CCCCAGCGCCGGCGCGGCTCAGG - Exonic
1084129178 11:67119742-67119764 CCCGAGCCCCGGGCCGGCCCCGG - Exonic
1084570951 11:69959564-69959586 CCCCAGCTGCGAGGCTGCTCTGG + Intergenic
1084779042 11:71396783-71396805 ACCCAGCCGCGGGGCGCCTGGGG + Intergenic
1085474808 11:76783229-76783251 GGCCGGCCGCGGGGCGGCTCAGG - Intronic
1088690275 11:112320808-112320830 CCCAAGCCGCAGGGACGCACAGG + Intergenic
1091293161 11:134453692-134453714 CCCCAGCTGCACGGCGGCTCTGG + Intergenic
1095703887 12:45217020-45217042 CCCAAGCCCCAGGGCCCCTCAGG - Intronic
1104376380 12:128267736-128267758 CCTCATCCGCGGGGCAGCTCTGG - Intronic
1105577909 13:21670273-21670295 CCCAAGCCGTGCATCGGCTCGGG - Intergenic
1106480479 13:30133612-30133634 CCCCAGCCGCAGGGCCGCGCAGG + Intergenic
1108615589 13:52128974-52128996 CCGAAGCCCTGTGGCGGCTCCGG + Intronic
1113536271 13:111068589-111068611 CCCAAGCATCGGGGCTGCTTTGG + Intergenic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1115976625 14:39004078-39004100 CCCAAGCCCCGGGAGTGCTCAGG - Intergenic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1121168889 14:91836537-91836559 CCCGAGGGGCGGGGCGGCCCTGG - Intronic
1122140439 14:99660030-99660052 TCCAAGGCGCAGGGAGGCTCCGG - Intronic
1122779186 14:104136483-104136505 GGCGCGCCGCGGGGCGGCTCGGG - Intergenic
1124539012 15:30568962-30568984 CCCAAGGCGAGAGGCGGCCCTGG - Intergenic
1125677599 15:41511248-41511270 CCCAAGCCTCGGAGCAGCCCTGG + Exonic
1126066632 15:44830693-44830715 CCTAAGCAGCGGGGCAACTCAGG + Intergenic
1126093250 15:45070176-45070198 CCTAAGCAGCGGGGCAACTCAGG - Intronic
1128322562 15:66703488-66703510 CCCAGGGCGCGGGGAGGCGCCGG + Exonic
1130282709 15:82532067-82532089 CCCAAGGCGAGGGGTGGCCCTGG - Intergenic
1133234976 16:4383609-4383631 CCCAAGCCCAGGGGCTGCTGAGG - Intronic
1138659679 16:58509713-58509735 CCCAAGCCCTGGGGCGGGTGAGG - Intronic
1143124548 17:4633160-4633182 CCCAAGATGCGCTGCGGCTCTGG - Exonic
1146716458 17:35090123-35090145 GCCAAGCAGCAGGGCGGCCCAGG + Intronic
1148462528 17:47846841-47846863 ACCCCGCCGCAGGGCGGCTCCGG + Exonic
1148554286 17:48568977-48568999 CCCAGCCCGCGGTGTGGCTCCGG + Intronic
1151190594 17:72395034-72395056 TCCAAGCCTCGGGGGAGCTCAGG - Intergenic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151497480 17:74467292-74467314 CCCCAGCCGCTGGGCTGCCCTGG - Intronic
1152096138 17:78272734-78272756 TCCAACCCACGGGACGGCTCGGG - Intergenic
1152563648 17:81090736-81090758 CCCGAGCTGCGGGGAGGCTGCGG + Intronic
1153382637 18:4455489-4455511 CCCAGGCCGCGGGGAGGCGCCGG + Intergenic
1157490590 18:48121026-48121048 CCCAAGACCAGGGGCAGCTCTGG - Intronic
1157601251 18:48894432-48894454 GCCAAGCAGAGGGGCTGCTCAGG - Intergenic
1157849027 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG + Exonic
1159798457 18:72869083-72869105 CCCCAGCCGCGGCGCGGGTGTGG - Intergenic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1167557154 19:50203643-50203665 CCGAAGCCTCGGGACGGCCCTGG + Exonic
925891236 2:8436799-8436821 CCCCAGCCCAGGTGCGGCTCTGG - Intergenic
927787129 2:25981941-25981963 CCCAGGCTGCGGAGGGGCTCGGG - Exonic
929788753 2:45009339-45009361 CCCAAGCCCGGGGGCCGCCCGGG + Exonic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
938931183 2:136088157-136088179 CCCACGCGGCCGGGAGGCTCAGG + Intergenic
1170630023 20:18057767-18057789 CCCCCGCCGCGGCGCGGCCCAGG + Exonic
1170969570 20:21104577-21104599 CCCAGGACGCGGGGCAGCTTCGG + Intergenic
1172454665 20:35059407-35059429 CCCAAGACTCTGGGCGGCTGAGG + Intronic
1175961292 20:62637871-62637893 CCAGACCCGCGGGGAGGCTCAGG + Intergenic
1180037344 21:45256642-45256664 CCCCAGCCCGGGGGCAGCTCTGG - Intergenic
1180181520 21:46120527-46120549 GCCAGGCCGCGGGGCCCCTCAGG - Exonic
1181051474 22:20240181-20240203 CCCAAGGCTGGGGGCAGCTCAGG - Intergenic
1182521923 22:30889628-30889650 CCCATGCCGGTGGGTGGCTCGGG + Exonic
1185062872 22:48616139-48616161 CACCAGCCCCGGGGCTGCTCAGG + Intronic
953326202 3:42014006-42014028 CCGAAGCCGCCGGGCGGCCGGGG + Intronic
954110338 3:48429724-48429746 CCGACGGGGCGGGGCGGCTCTGG - Intronic
954618600 3:51983272-51983294 CGCAACTCGCGGGGCGGCGCTGG + Exonic
962591040 3:136890088-136890110 CCCATGGGGCGGGGAGGCTCAGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968897702 4:3414344-3414366 CCCCTGCCACGGGGCTGCTCAGG - Intronic
968908804 4:3466374-3466396 CACTAGCCGTGGGGCAGCTCCGG - Intronic
971279940 4:25234409-25234431 CTGAAACCGCGGGGCGGCTCCGG - Exonic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
983533418 4:168833067-168833089 CCCCAGCCCCGGGGCGGGGCCGG - Intronic
986449222 5:7849927-7849949 CCCAGCCCGCTGGGCGGCCCCGG + Intronic
990665686 5:58069224-58069246 CCCCAGCGGTGGGGAGGCTCAGG + Intergenic
991587468 5:68215523-68215545 CCCCAGCCGCGGGGATGCCCCGG - Intergenic
992527564 5:77628020-77628042 CCCCAACCCCGGGGCTGCTCTGG - Intergenic
1001567359 5:172708100-172708122 CCCCAGCTGAGTGGCGGCTCTGG + Intergenic
1002158899 5:177303519-177303541 CCCAAGCCTCGGGGCGGCCTGGG + Exonic
1002317238 5:178351036-178351058 CCAAAGCCCCGGGGCTGCTCAGG + Intronic
1003643670 6:7896811-7896833 CCCATGCCGGGGGACTGCTCTGG - Intronic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1005526804 6:26659452-26659474 CCCAGGCCTAGGGGCGGCGCCGG - Exonic
1006475230 6:34248831-34248853 CCCACGGCGCTGGGAGGCTCAGG + Intronic
1006834092 6:36986260-36986282 TCCAGGCCGCGGGGGAGCTCGGG + Exonic
1006932435 6:37696332-37696354 CGCAAGCCGCGCGGCAACTCCGG + Intronic
1007605340 6:43113984-43114006 CACAGGCCCCGGGGCTGCTCAGG - Intronic
1014272492 6:119349660-119349682 CCGCAGCCCCGGCGCGGCTCAGG + Exonic
1018845511 6:167552557-167552579 CCCAAGCCACATGGCGTCTCAGG + Intergenic
1025829805 7:65038755-65038777 CCCAGGCCGCGGGGCGGAGGTGG + Intergenic
1025917060 7:65873755-65873777 CCCAGGCCGCGGGGCGGAGGTGG + Intronic
1026091212 7:67302409-67302431 CCCAGGCCCCGAGGCGGATCGGG - Intergenic
1034421623 7:150993834-150993856 CCCAGGCCGCAGGGTGGCCCAGG - Exonic
1035716991 8:1763134-1763156 ACCGAGCCCCGGGGAGGCTCCGG + Intronic
1048009403 8:130443802-130443824 CCCCCGGCGCGGAGCGGCTCGGG - Intergenic
1049375734 8:142288196-142288218 CCCCAGCCGCTGGGCGTCCCAGG - Intronic
1053000289 9:34574114-34574136 CCCAAGCCTCTGGACCGCTCAGG - Intronic
1056386191 9:86099282-86099304 CGCAAGCCGCGGGGAGGCTCCGG + Intronic
1056561398 9:87733018-87733040 CCCAAGCCATGGGGAGGCCCCGG - Intergenic
1056595740 9:88006667-88006689 CACAAGCCGGGTCGCGGCTCTGG + Intergenic
1056677217 9:88686005-88686027 CCACAGCAGCGGGGAGGCTCGGG + Intergenic
1057682253 9:97199857-97199879 CCCAGGCCTAGGGGCGGCGCCGG - Intergenic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1060305350 9:122406286-122406308 CCCACGGCGCGGGGCGGCTCAGG + Intergenic
1060608627 9:124940852-124940874 CCCAAGGCGGGGGGCGGCACCGG - Intronic
1061899197 9:133664359-133664381 CCCCAGCCTCGGCGCTGCTCTGG - Intronic
1062352232 9:136144857-136144879 CCCAGGACGTGGGGCGGCACTGG - Intergenic
1062529192 9:136992486-136992508 CACACGAAGCGGGGCGGCTCGGG - Exonic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1198468131 X:136921636-136921658 CCCATGGCGGGGGGAGGCTCAGG - Intergenic
1199772698 X:150984303-150984325 CCCGAGCCCCCGGGCGGCCCGGG + Intronic