ID: 1057710226

View in Genome Browser
Species Human (GRCh38)
Location 9:97434340-97434362
Sequence TAACCCCACGTCCCTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057710226_1057710233 13 Left 1057710226 9:97434340-97434362 CCAAAGGCAGGGACGTGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1057710233 9:97434376-97434398 GGACGTACACAATTTCAGTTAGG No data
1057710226_1057710232 -8 Left 1057710226 9:97434340-97434362 CCAAAGGCAGGGACGTGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1057710232 9:97434355-97434377 TGGGGTTAGGATGGGGGTTGTGG No data
1057710226_1057710234 22 Left 1057710226 9:97434340-97434362 CCAAAGGCAGGGACGTGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1057710234 9:97434385-97434407 CAATTTCAGTTAGGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057710226 Original CRISPR TAACCCCACGTCCCTGCCTT TGG (reversed) Intronic
900623788 1:3599037-3599059 TCACCCCGCGGCCCTGCCTGAGG + Intronic
902334985 1:15749520-15749542 AAACCACCCGGCCCTGCCTTGGG - Intergenic
903779613 1:25812909-25812931 TCACCCCACGCCCCTACCATGGG - Intronic
904044704 1:27602600-27602622 TCACCCCAGCTCCCTGCCTAGGG + Intronic
907380867 1:54086877-54086899 TAGCCCCGCTGCCCTGCCTTAGG - Intronic
907798143 1:57738030-57738052 TTACCTCACCTCCTTGCCTTGGG + Intronic
911516246 1:98871646-98871668 TAACCACAAGTTCCTGCTTTAGG - Intergenic
912910685 1:113756690-113756712 TAACCCCACAACTCTGACTTTGG + Intronic
913958976 1:143324646-143324668 TAACCCACCCTCCCTGCCGTGGG + Intergenic
914053293 1:144150026-144150048 TAACCCACCCTCCCTGCCGTGGG + Intergenic
914125904 1:144816515-144816537 TAACCCACCCTCCCTGCCGTGGG - Intergenic
915486153 1:156222144-156222166 TACTCCCACGGCCCTGACTTGGG - Intronic
916590183 1:166182651-166182673 TGACTGCACGTCCCTGGCTTGGG - Intergenic
920350957 1:205337655-205337677 TCACCCCACCTCCCTCCCTTCGG + Intronic
923923858 1:238601245-238601267 CATCCCCACTTCCATGCCTTTGG - Intergenic
1063653224 10:7961247-7961269 TGACCCCAGGTTCCTGACTTGGG + Intronic
1064179670 10:13103046-13103068 TACTCCCAGGTTCCTGCCTTGGG + Intronic
1066098345 10:32094514-32094536 TATTCCCACAACCCTGCCTTGGG + Intergenic
1066758721 10:38735974-38735996 TAACCCACCCTCCCTGCCATAGG - Intergenic
1066962926 10:42236794-42236816 TAACCCACCCTCCCTGCCATGGG + Intergenic
1067441217 10:46310115-46310137 TCGCCCCACTTCCCTTCCTTAGG - Intronic
1069821044 10:71228974-71228996 TAAGGCCCAGTCCCTGCCTTGGG - Intronic
1073996645 10:109323335-109323357 TTCCCCCAGGCCCCTGCCTTTGG + Intergenic
1075512960 10:123086978-123087000 GAAGCCCAAGTCCTTGCCTTTGG - Intergenic
1076345580 10:129776763-129776785 TACCCCCTCTTCCCTCCCTTTGG + Intergenic
1077201767 11:1311124-1311146 TAACCACAAGTTCCTGCTTTGGG + Intergenic
1078102926 11:8340339-8340361 AAACCAAAGGTCCCTGCCTTGGG - Intergenic
1081988958 11:47327471-47327493 TCTCCCCAGGTCTCTGCCTTGGG + Intronic
1083293212 11:61701204-61701226 TAATCCCACCTCCATCCCTTGGG + Intronic
1085456015 11:76665817-76665839 CACCCCCACCTCCCTGCCCTAGG - Intronic
1088565808 11:111171602-111171624 TGAGACCAAGTCCCTGCCTTTGG - Intergenic
1089124182 11:116164769-116164791 TTACCCCACATCCCTTCCCTGGG + Intergenic
1093975831 12:25420974-25420996 TAACCATACTTCTCTGCCTTTGG - Intronic
1097056760 12:56254796-56254818 CAACCCCACATCCCTGCCCTAGG + Intronic
1102028931 12:109728946-109728968 TAACCCCACTGCCTTGCCCTGGG - Intronic
1102649112 12:114424751-114424773 TAAACCCACATCCTTGCTTTTGG - Intergenic
1103732729 12:123038666-123038688 GAGCCCCACGTTCCTGCCCTGGG - Intronic
1104709985 12:130978968-130978990 TCCCGCCACTTCCCTGCCTTGGG - Intronic
1114551540 14:23535250-23535272 CAATGCCCCGTCCCTGCCTTCGG - Exonic
1115378388 14:32704926-32704948 TAGCCCCACATTCCTGCTTTAGG - Intronic
1118951732 14:70441614-70441636 TTAACCCAGGTCCCAGCCTTAGG - Intergenic
1122632170 14:103112027-103112049 TAACCCCACAGCCCTGCCCCAGG - Intergenic
1122824358 14:104362418-104362440 TGACCCCACCTCCCTGCCCAGGG - Intergenic
1123422861 15:20145678-20145700 TAACCCACCTTCCCTGCCGTGGG + Intergenic
1123532087 15:21152218-21152240 TAACCCACCTTCCCTGCCGTGGG + Intergenic
1127664193 15:61128915-61128937 TGGCACCACGTGCCTGCCTTGGG + Intronic
1132216092 15:100062837-100062859 TAATCCCATGTTCCTGTCTTGGG - Intronic
1136719071 16:32304879-32304901 TAACCCACCCTCCCTGCCGTGGG + Intergenic
1136724094 16:32343235-32343257 TAACCCACCCTCCCTGCCATGGG + Intergenic
1136837442 16:33511143-33511165 TAACCCACCCTCCCTGCCGTGGG + Intergenic
1137724903 16:50650571-50650593 TACCCCCAAGTCTCTGTCTTAGG - Intergenic
1140931221 16:79630162-79630184 CTACCCCACGTCCATGCATTTGG - Intergenic
1203002337 16_KI270728v1_random:174530-174552 TAACCCACCCTCCCTGCCATGGG - Intergenic
1203007360 16_KI270728v1_random:212892-212914 TAACCCACCCTCCCTGCCGTGGG - Intergenic
1203133942 16_KI270728v1_random:1710936-1710958 TAACCCACCCTCCCTGCCATGGG - Intergenic
1203147624 16_KI270728v1_random:1811422-1811444 TAACCCACCCTCCCTGCCGTGGG + Intergenic
1143287387 17:5800478-5800500 TCTCTCCCCGTCCCTGCCTTTGG + Intronic
1146735575 17:35235955-35235977 GAATCCCAGGTGCCTGCCTTGGG + Intergenic
1148192295 17:45688042-45688064 TAAGGCCAAGTCCCTGCCTGGGG + Intergenic
1151140777 17:71990198-71990220 TAACCCCACCCCACTGCCTCTGG + Intergenic
1151529867 17:74697325-74697347 CAGCCCCACATCCCTGCCCTAGG + Intronic
1151951404 17:77356283-77356305 CAGCCCCATCTCCCTGCCTTGGG + Intronic
1157562312 18:48656998-48657020 TCACCCCTCGTCCTAGCCTTGGG - Intronic
1159335420 18:67058200-67058222 TAACCCCACATCCATCACTTTGG - Intergenic
1160899741 19:1421713-1421735 TGACCACACGCCCCTGCCTTGGG - Intronic
1162740716 19:12772120-12772142 TATCCCCAACTCCCGGCCTTTGG + Intronic
1163672870 19:18638637-18638659 GAACCCCAGGTCCCTGCCTTGGG + Intronic
1164678472 19:30118724-30118746 GCACCCCTGGTCCCTGCCTTGGG + Intergenic
1165757841 19:38304543-38304565 TGACCCCAGGGTCCTGCCTTAGG + Intronic
1166010907 19:39941973-39941995 TAACCACAAGTTCCTGCTTTAGG - Intergenic
1166012584 19:39953616-39953638 TAACCACAAGTTCCTGCTTTAGG - Intergenic
1166126753 19:40719184-40719206 TCACCCCACATGCCTTCCTTGGG + Intronic
1202692691 1_KI270712v1_random:102449-102471 TAACCCACCCTCCCTGCCGTGGG + Intergenic
927636475 2:24820592-24820614 TTGCCCCACGTCTCTGCCTCTGG + Exonic
929807195 2:45156696-45156718 TAACTCCAGCTCCCTGCATTTGG - Intergenic
931855091 2:66294577-66294599 TAGCCTCACCTCCCTGACTTTGG + Intergenic
931982810 2:67712440-67712462 TAACCCCAACCCCTTGCCTTAGG + Intergenic
933953711 2:87351515-87351537 TAACCCACCCTCCCTGCCGTGGG - Intergenic
934237916 2:90247769-90247791 TAACCCACCCTCCCTGCCATGGG - Intergenic
934275286 2:91568968-91568990 TAACCCACCCTCCCTGCCGTGGG + Intergenic
934322044 2:91980319-91980341 TAACCCACCCTCCCTGCCGTGGG - Intergenic
934460330 2:94211105-94211127 TAACCCACCCTCCCTGCCGTGGG - Intergenic
934906862 2:98212915-98212937 TAACAGCTCATCCCTGCCTTTGG + Intronic
936339423 2:111618109-111618131 CAACCCCACTTCCCTGGGTTGGG - Intergenic
938181235 2:129187058-129187080 GAGCCCCAGGTCCCAGCCTTAGG - Intergenic
942116330 2:172733166-172733188 TATTCCCACCTCCCAGCCTTAGG + Intergenic
947195720 2:227565122-227565144 CAGCCCCACTTCCCTGCCCTTGG - Intergenic
1169548823 20:6680028-6680050 CAAACCCACCTCACTGCCTTGGG + Intergenic
1170134912 20:13062053-13062075 TACCCACACGTGCCTGCCTCAGG + Intronic
1170613202 20:17930261-17930283 AAACCCCACTCCCCTGCCCTCGG + Intergenic
1171020132 20:21577239-21577261 TACCCCCTGGTCCCAGCCTTGGG - Intergenic
1172113154 20:32559300-32559322 TATCCCCACACCCCTGCCTCAGG + Intronic
1173413591 20:42837115-42837137 GACGCCCACGTCCCTGCTTTGGG - Intronic
1173591903 20:44231425-44231447 TGACCCGGCCTCCCTGCCTTTGG + Intergenic
1173843181 20:46172337-46172359 TAACCCCACATCCCTGCCACTGG + Intergenic
1175594351 20:60218814-60218836 TAATCCCATTTGCCTGCCTTTGG + Intergenic
1175690080 20:61058713-61058735 TCCCCCAAAGTCCCTGCCTTGGG + Intergenic
1175921827 20:62453696-62453718 TGACCCCACCCCCCTGCCCTGGG - Intergenic
1176039626 20:63058526-63058548 CACCCCCAAGCCCCTGCCTTGGG + Intergenic
1176068788 20:63215610-63215632 GTACCCCACGTCCCGGCCTGCGG - Intronic
1176591457 21:8654143-8654165 TAACCCACCCTCCCTGCCGTGGG - Intergenic
1177915556 21:27084566-27084588 TCACCCCACCTCCCTGCCTGTGG + Intergenic
1180252074 21:46596528-46596550 TGACCCCATGCCCCTGCCTGGGG - Intergenic
1180274305 22:10631254-10631276 TAACCCACCCTCCCTGCCGTGGG - Intergenic
1180548791 22:16526235-16526257 TAACCCACCCTCCCTGCCGTGGG - Intergenic
949897238 3:8777100-8777122 AAGCCCCAAATCCCTGCCTTCGG + Intronic
951722155 3:25711700-25711722 AAACCCCACATCCCTGTCTCTGG - Intergenic
954252556 3:49379360-49379382 CACCCCCAAGTCCCTGCCCTAGG - Intronic
955739178 3:62071755-62071777 CAACCCCACTTTCCTTCCTTAGG + Intronic
959929910 3:111968926-111968948 TAACCCCACCTCTTTGCCTCGGG - Intronic
967095775 3:186176069-186176091 CAAGCTCACCTCCCTGCCTTCGG - Intronic
969788270 4:9474701-9474723 TAACCCCGCCCCCCTGCCATGGG - Intergenic
970192845 4:13531475-13531497 TGCCCCCACCGCCCTGCCTTTGG + Intergenic
971776653 4:30974939-30974961 TAACCCTACGTGCCTAACTTAGG - Intronic
976194790 4:82522179-82522201 TAACCACAGCTCCCTGCCTTGGG + Intronic
982346590 4:154367071-154367093 GTACACCACGTTCCTGCCTTAGG - Intronic
985778496 5:1857463-1857485 TCGCCCGACGTCCCCGCCTTCGG - Intergenic
986589708 5:9355859-9355881 AAAGCCCACATCCCTGCATTAGG + Intronic
987181189 5:15369914-15369936 GTCCCCCACCTCCCTGCCTTTGG - Intergenic
990336291 5:54775985-54776007 TAACCCTCTGTCCCTGCCTCTGG + Intergenic
997417637 5:133741217-133741239 TAAATCCAAATCCCTGCCTTAGG - Intergenic
999318711 5:150600409-150600431 GATCCCCACTTCCCTGCCTGGGG - Intergenic
1006521655 6:34574432-34574454 CAACCCCCTGTCCCTGCCTCGGG - Intergenic
1007707838 6:43801953-43801975 TGACCACACGGCCCCGCCTTTGG + Intergenic
1009044592 6:58222691-58222713 TAACACCAGATCCCTGACTTTGG - Intergenic
1021075423 7:16298373-16298395 TAACCACAAGTCTCTGCCTTAGG - Intronic
1021815177 7:24439841-24439863 CAACCCCACTTCCATGCCTTTGG + Intergenic
1022527822 7:31049740-31049762 TACCCCTACGTGCCTGGCTTTGG - Intergenic
1025784943 7:64635612-64635634 TTTCCCCACTTCCCTGCCTTTGG - Intergenic
1027548739 7:79563886-79563908 TAACCACAAGTCCCTGCTTTAGG + Intergenic
1029178723 7:98683999-98684021 TAAACCCAAGTCCCTGCCCTTGG + Intergenic
1029256360 7:99272379-99272401 TCACTCCACATCCCTGCCCTTGG + Intergenic
1033599234 7:142876968-142876990 TTACCCCACGACCCTTCCTCTGG - Intronic
1035277517 7:157756990-157757012 TGGCCCCACATCCCTGACTTCGG - Intronic
1036692202 8:10951153-10951175 GCACCCCAGGTCCCTGCCCTTGG + Intronic
1037754257 8:21701033-21701055 TAAGCCCTCGCCCCTGCCTTTGG - Intronic
1041053682 8:53961167-53961189 GAAACCCAAGTCCATGCCTTAGG - Intergenic
1047294858 8:123561827-123561849 TAACCACACCTCCTTTCCTTTGG + Intergenic
1049992964 9:1007252-1007274 TTACCCTTTGTCCCTGCCTTTGG + Intergenic
1050088475 9:1991620-1991642 TTACCACACTTCTCTGCCTTTGG + Intergenic
1057222516 9:93264882-93264904 TTGCCCCACGTGCCTGCCTGCGG + Intronic
1057710226 9:97434340-97434362 TAACCCCACGTCCCTGCCTTTGG - Intronic
1062410577 9:136422128-136422150 CGACCCCACGACCCTGCCCTTGG - Intronic
1203621484 Un_KI270749v1:132907-132929 TAACCCACCCTCCCTGCCGTGGG - Intergenic
1186015188 X:5183323-5183345 CAACAGCACGTCACTGCCTTTGG - Intergenic
1187048708 X:15675246-15675268 CTACCCCACCTCCCTCCCTTGGG - Intergenic
1187186638 X:16992978-16993000 TAACACCAGCTCCCTGGCTTTGG - Intronic
1188005008 X:25011167-25011189 CAACCCCAGGTCCCAGGCTTCGG - Intronic
1190761478 X:53441334-53441356 GCACCCCACATCCCCGCCTTTGG - Intergenic
1194628949 X:96259400-96259422 TAGCCCCAAATCCCTGGCTTTGG + Intergenic
1195016238 X:100784417-100784439 TCAGCCCACTTCCCTCCCTTTGG - Intergenic
1195913583 X:109914055-109914077 CAACCCCACATCTCTTCCTTAGG - Intergenic
1197000799 X:121437446-121437468 TTTCCCCACCTCCCTGCCTCTGG + Intergenic
1201861966 Y:18608346-18608368 TGAACCCACCTCCCTGGCTTGGG - Intergenic
1201871357 Y:18712034-18712056 TGAACCCACCTCCCTGGCTTGGG + Intergenic
1202350818 Y:23989020-23989042 TAAATCCACCTCCCTGGCTTAGG + Intergenic
1202519961 Y:25681099-25681121 TAAATCCACCTCCCTGGCTTAGG - Intergenic
1202584113 Y:26406475-26406497 TAACCCACCCTCCCTGCCATGGG + Intergenic