ID: 1057710233

View in Genome Browser
Species Human (GRCh38)
Location 9:97434376-97434398
Sequence GGACGTACACAATTTCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057710226_1057710233 13 Left 1057710226 9:97434340-97434362 CCAAAGGCAGGGACGTGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1057710233 9:97434376-97434398 GGACGTACACAATTTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057710233 Original CRISPR GGACGTACACAATTTCAGTT AGG Intronic
No off target data available for this crispr