ID: 1057710374

View in Genome Browser
Species Human (GRCh38)
Location 9:97436383-97436405
Sequence ATTCACATAAGACCTATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057710374_1057710377 13 Left 1057710374 9:97436383-97436405 CCCATTATAGGTCTTATGTGAAT 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1057710377 9:97436419-97436441 CCTTTACATAATTTTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057710374 Original CRISPR ATTCACATAAGACCTATAAT GGG (reversed) Intronic
901427840 1:9194242-9194264 ATTGACATAAGCCCTGCAATAGG + Intergenic
907766903 1:57422069-57422091 ATTTCCCAAAGACCTATAATTGG + Intronic
908012271 1:59790867-59790889 AGTCTCATCAGATCTATAATAGG + Intergenic
910464491 1:87482967-87482989 CTTCACAATAGACATATAATAGG - Intergenic
911527242 1:99002748-99002770 ATTTAAATAAGACATAGAATGGG + Intronic
912044886 1:105441971-105441993 ACTCACATAAGTCTTAGAATTGG - Intergenic
916425391 1:164675324-164675346 ATTCACTTAAGAAGTATTATAGG + Intronic
916955544 1:169829896-169829918 ATTCACATACAACATTTAATAGG - Intronic
921995080 1:221409508-221409530 ATTTACATATCACCTCTAATAGG + Intergenic
922687826 1:227660945-227660967 ATTCACTTAAAAGTTATAATTGG + Exonic
1062943560 10:1443025-1443047 ATTGAAATAACACCTACAATGGG + Intronic
1068448273 10:57152052-57152074 TCTCAAATAAGACCTATAAATGG + Intergenic
1072863167 10:99028651-99028673 AACCACAAAAGACCTACAATAGG + Intronic
1074199200 10:111219195-111219217 TTTCACCCAAGACCTAGAATGGG + Intergenic
1075847737 10:125558900-125558922 ATTGCCATAAGACCTTTGATTGG - Intergenic
1076239618 10:128894549-128894571 AGCCACATAAGACCAATGATTGG - Intergenic
1077654791 11:4008345-4008367 ATTCACTTATGACATATGATGGG - Intronic
1081392701 11:42547738-42547760 ATTCACACAATTCTTATAATAGG + Intergenic
1084928787 11:72536707-72536729 ATTCACATCAGGCCAAAAATTGG - Intergenic
1086479079 11:87214445-87214467 ATTAACAGAAGACCTGTATTGGG + Intronic
1089990483 11:122854734-122854756 TTTAACATAATACATATAATTGG + Intronic
1092520100 12:9262627-9262649 ATTCACCTCAAACCTATTATTGG - Intergenic
1093577665 12:20753215-20753237 ATTCATAAAAGAACAATAATTGG - Intronic
1096768243 12:53912616-53912638 TTTCAAATTAGACCTCTAATAGG - Intergenic
1098814036 12:75134259-75134281 ATTCACTTAATGCCTATTATAGG - Intronic
1100133557 12:91526036-91526058 AATCAAATAAAACGTATAATTGG + Intergenic
1100349967 12:93771398-93771420 ATTCACAAAAGAACTACAAATGG - Intronic
1101257146 12:102989751-102989773 ATGCCCAGAAGAACTATAATGGG + Intergenic
1102064343 12:109961059-109961081 ATTCACAGAAGAAATATAAATGG - Intronic
1104238643 12:126964479-126964501 TTTCACAGAAGACATATAAATGG + Intergenic
1106450498 13:29877542-29877564 ATTCACAAAAGACCTGCAACAGG + Intergenic
1106884004 13:34163147-34163169 ATTCAGATCAGTCCTAAAATTGG + Intergenic
1108255507 13:48606126-48606148 AACCACAAAAGACCTAGAATAGG - Intergenic
1108823062 13:54377164-54377186 ATTCAAATAAGAGCTGAAATGGG + Intergenic
1110270987 13:73590347-73590369 ATTATCATAAGACCTATGAGGGG + Intergenic
1111011347 13:82318982-82319004 ATCCACAGTGGACCTATAATGGG - Intergenic
1117626337 14:57643532-57643554 AATCACTTAAGACCTACAGTAGG + Intronic
1128967465 15:72073772-72073794 ATTTACATAATACTTATCATTGG - Intronic
1137954532 16:52815535-52815557 ATTCAAATTAGACCTTTGATTGG - Intergenic
1138045341 16:53717413-53717435 AATCACAAAAGAACTATATTTGG - Intronic
1144030179 17:11313315-11313337 ATTCATAGAAGACATATAAGTGG - Intronic
1146737322 17:35249879-35249901 ACTCACATAGGACGAATAATTGG + Intronic
1146901092 17:36589078-36589100 AGTCACATAAAGCCTTTAATTGG - Intronic
1150545026 17:66147634-66147656 CTAAACATAAGAGCTATAATAGG - Intronic
1153163584 18:2237544-2237566 ATTCTCATAAGACCTTTATGTGG - Intergenic
1155076254 18:22358142-22358164 AATCACATAAAACCTATGTTTGG - Intergenic
1155458114 18:26043494-26043516 CTCCAAATAAGAGCTATAATTGG - Intronic
1155762448 18:29584964-29584986 ATTCTCATAATGCCTATATTGGG - Intergenic
1156590121 18:38478063-38478085 TTTCACAGAAGACATATAACTGG - Intergenic
1157037506 18:43993074-43993096 ATTCACAAAAGACTTATATTTGG + Intergenic
1166575343 19:43832077-43832099 ATTAACATAAAACCTAGAACTGG - Intronic
927994640 2:27475081-27475103 ATTCACAGAAGAAATATAAATGG + Intronic
928106229 2:28472217-28472239 TTCCACATAACACCTAAAATGGG + Intronic
936996490 2:118420029-118420051 GTTGACAGAAGATCTATAATGGG - Intergenic
937479873 2:122246784-122246806 TTTTAAATAAGACTTATAATTGG + Intergenic
941294781 2:163723294-163723316 TATAGCATAAGACCTATAATAGG - Intronic
943515381 2:188879658-188879680 ATTTACAAAAGGCCTATAGTGGG + Intergenic
945358662 2:208869102-208869124 ATTAACATAAGACTTAAAAAGGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169041591 20:2499846-2499868 ATTCAGGTAAGAACTATAAGAGG - Intronic
1169904175 20:10584051-10584073 GTTCACATAAGATGTATATTGGG - Intronic
1170449906 20:16472159-16472181 ATGCAGATAAGACCTCAAATGGG - Intronic
1170778417 20:19401511-19401533 ATTCTCATCAGCCCAATAATGGG - Intronic
1174246215 20:49183182-49183204 TTTCACACTAGACCTATAACAGG - Intronic
1177374398 21:20250507-20250529 ATTCTCATAAGACCTGGAACTGG - Intergenic
1177539104 21:22468476-22468498 ATTCATGTAAGAACTATAGTTGG + Intergenic
1177600978 21:23313573-23313595 ATTCACAGAACATCTATTATGGG + Intergenic
1178192574 21:30301795-30301817 AGAGAAATAAGACCTATAATAGG - Intergenic
1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG + Intergenic
1183270289 22:36857944-36857966 ATTCACAGAAGAAATATAAAAGG - Intergenic
1183852285 22:40600409-40600431 ATGCACATCACACCGATAATCGG - Intronic
950769941 3:15303290-15303312 ATTCACATTAGCTCTCTAATCGG + Intronic
951023111 3:17802006-17802028 ATTCACATATTACTTATATTTGG + Intronic
952389462 3:32867283-32867305 ATTTACATAATACATATAATGGG + Intronic
953391714 3:42537595-42537617 ATTCTCATATGGCCTAAAATGGG + Intergenic
957345266 3:78952486-78952508 ATTAACATAAATCCTATCATGGG + Intronic
957376624 3:79367111-79367133 AATCACATAATTCCTGTAATTGG - Intronic
957581688 3:82081456-82081478 ATTCAAATAAGCTTTATAATAGG - Intergenic
957635054 3:82772409-82772431 ATTTATGGAAGACCTATAATTGG + Intergenic
957676939 3:83379129-83379151 ATTTACATAAGACAGATAACAGG + Intergenic
960492149 3:118330631-118330653 ATTCACATAAGCCATTTATTGGG + Intergenic
961122750 3:124386651-124386673 ATTCACATTAGAACCATAAGGGG - Intronic
961926474 3:130486923-130486945 ATGCACATAAGAGCTAAGATGGG + Intergenic
963700377 3:148618544-148618566 ATTAACCTAATACCTATTATAGG + Intergenic
964692753 3:159470492-159470514 ATTAACAACAGAGCTATAATGGG + Intronic
964979718 3:162664813-162664835 ATTTTCAAAAGACCTATATTAGG + Intergenic
966456244 3:180119337-180119359 ATTCACAGAAGAAATATAAATGG - Intergenic
966479736 3:180393440-180393462 ATTCACACAAGAAATATAAATGG + Intergenic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
967660788 3:192106940-192106962 ATTCACATAGGAATCATAATAGG + Intergenic
968430076 4:551857-551879 ATTCACTTAAGTTCTAGAATGGG - Intergenic
975000001 4:69212268-69212290 ATTCAAATAATACTTATAAAAGG - Intronic
976720897 4:88167684-88167706 AATCACATAAGCCCTTTAAAAGG - Intronic
978401526 4:108335872-108335894 ATTCCCATAACTCCTATATTGGG + Intergenic
978732397 4:112044147-112044169 ATTGACATATGACATAAAATTGG - Intergenic
979201342 4:117982710-117982732 ATACCCATATTACCTATAATAGG - Intergenic
979758339 4:124369453-124369475 ATTCATATAAGTCCAATAAAAGG - Intergenic
980040027 4:127928451-127928473 ATTCTCAAAAGACATATAAAAGG + Intronic
982077534 4:151752857-151752879 ATTTACATAGGACTTTTAATTGG - Intronic
983771799 4:171559478-171559500 ATACACATATGACCTGAAATAGG + Intergenic
985175270 4:187193730-187193752 ATGCACTAAATACCTATAATAGG + Intergenic
987339208 5:16924287-16924309 GTTCACAGAAGACCTAAAAATGG + Intronic
989708375 5:44365989-44366011 ATTCATATAACACCAATAAATGG - Intronic
990492618 5:56317539-56317561 TTTCACAAAAGGCTTATAATGGG - Intergenic
991213628 5:64135285-64135307 ATACAAATAATATCTATAATTGG - Intergenic
992787336 5:80182876-80182898 ATTGACATAAGACCAATTACAGG - Intronic
993241197 5:85388146-85388168 TTTCAGATAAGACCTGTGATTGG + Intergenic
995778500 5:115750923-115750945 ATTAACAAAAGACCTTTATTAGG - Intergenic
996200775 5:120669427-120669449 ATTCACATAAGAGCTATATAAGG - Intronic
996224565 5:120975607-120975629 ACTCACAGAACACATATAATTGG - Intergenic
1001098944 5:168798061-168798083 ATACACATAAGACATATAAATGG + Intronic
1010849960 6:80761674-80761696 ATTAGCATAAGAACTAGAATTGG - Intergenic
1011268301 6:85549385-85549407 ATGCACATTATAACTATAATAGG - Intronic
1012306070 6:97659340-97659362 AGTCTCAAAAGACCTTTAATTGG - Intergenic
1014483689 6:121972159-121972181 GTTCATATAAGACCTACATTTGG + Intergenic
1017444810 6:154497936-154497958 TTTCACATATCACCTAAAATAGG - Intronic
1018929646 6:168232557-168232579 ATTCTAATAAGACCTATACATGG + Intergenic
1021463622 7:20916614-20916636 ATTCTCATGAGATCTATAAAAGG + Intergenic
1022278196 7:28877411-28877433 ATACAAATAAAAACTATAATGGG - Intergenic
1024750347 7:52457965-52457987 ATTTACATAATACCTATAATAGG + Intergenic
1027430493 7:78107323-78107345 AATCACAAAAGACCTAGAGTAGG - Intronic
1027793859 7:82667411-82667433 ATATACATAAGACATATAAAAGG - Intergenic
1031466021 7:122112864-122112886 CTTAATAAAAGACCTATAATGGG + Intronic
1031603175 7:123738034-123738056 ATTCACAGAAGAAATATAAATGG + Intronic
1033918906 7:146363113-146363135 ATTTACATAGCACTTATAATAGG + Intronic
1037652558 8:20852173-20852195 GTTCACCTAAGAGATATAATGGG + Intergenic
1041867129 8:62587436-62587458 ATTCATATATGTTCTATAATTGG - Intronic
1044043221 8:87396644-87396666 AAACAGATAAGAGCTATAATAGG - Intronic
1044263966 8:90161172-90161194 GTGCACATTAGACTTATAATAGG - Intergenic
1044874681 8:96653353-96653375 ATTCTCAAAAGACATATAAATGG - Intronic
1045917329 8:107487477-107487499 ATTCATATAAGGCCTAACATTGG + Intronic
1046371378 8:113312729-113312751 ATGCAAATAATACCTATAAGTGG - Intronic
1048313661 8:133346278-133346300 ATTCACATAAGAAATACAAATGG - Intergenic
1048588279 8:135796391-135796413 CTTCAAATAAGATATATAATAGG - Intergenic
1050161276 9:2721091-2721113 ATACAGATAAGAGCAATAATTGG - Intronic
1057278728 9:93694990-93695012 ATGCACATTAGACCCACAATGGG + Intergenic
1057710374 9:97436383-97436405 ATTCACATAAGACCTATAATGGG - Intronic
1193168365 X:78307493-78307515 ATTCAGATGAGCCCTTTAATAGG - Intronic
1195342826 X:103921435-103921457 AATCACATAAGACCAAGAATAGG + Intronic
1195363965 X:104110122-104110144 AATCACATAGGACCAAGAATAGG - Intronic
1196080182 X:111622463-111622485 CTTCAAATAAGACATATAAATGG - Intergenic
1196742910 X:119041025-119041047 ATCCACATCAGTCCTATCATAGG + Intergenic
1199383692 X:147199719-147199741 ATACACACAAGACAGATAATGGG + Intergenic
1201786791 Y:17792459-17792481 AGTCACATATGCCCTATAATAGG + Intergenic
1201814762 Y:18113529-18113551 AGTCACATATGCCCTATAATAGG - Intergenic