ID: 1057713150

View in Genome Browser
Species Human (GRCh38)
Location 9:97465468-97465490
Sequence CCCTCTCCACCCTCTTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057713142_1057713150 29 Left 1057713142 9:97465416-97465438 CCTCTTCTGTAGCCAAGACACAG 0: 1
1: 1
2: 2
3: 17
4: 210
Right 1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG No data
1057713141_1057713150 30 Left 1057713141 9:97465415-97465437 CCCTCTTCTGTAGCCAAGACACA 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG No data
1057713145_1057713150 4 Left 1057713145 9:97465441-97465463 CCTTCTCCACAGCTGCTCCCAGC 0: 1
1: 1
2: 12
3: 79
4: 644
Right 1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG No data
1057713144_1057713150 17 Left 1057713144 9:97465428-97465450 CCAAGACACAGGTCCTTCTCCAC 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG No data
1057713146_1057713150 -2 Left 1057713146 9:97465447-97465469 CCACAGCTGCTCCCAGCGTAGCC 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057713150 Original CRISPR CCCTCTCCACCCTCTTGAAA AGG Intronic
No off target data available for this crispr