ID: 1057713204

View in Genome Browser
Species Human (GRCh38)
Location 9:97465903-97465925
Sequence CAGTGTCCTTCCCATCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057713204 Original CRISPR CAGTGTCCTTCCCATCATGA AGG (reversed) Intronic
903666919 1:25013699-25013721 CAGTTTCCTTCCCATTCTCAGGG + Intergenic
904367516 1:30024227-30024249 CAGGGTACTTGCCATCATGAAGG + Intergenic
904573752 1:31488273-31488295 CACTGTCATTGCCATCATTACGG + Intergenic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
907333799 1:53687711-53687733 CACTGTCCGTCCCTTCGTGAAGG - Intronic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
912127400 1:106555743-106555765 CTGTTTCCTTCCCTTCAGGATGG - Intergenic
913128038 1:115811492-115811514 CACTTTCCTTCCCAGCAAGAAGG + Intergenic
916782823 1:168054275-168054297 CAGAGTCCTTGCCAGCAAGAAGG - Intronic
918212668 1:182365141-182365163 TAGTTTCCTTCCCAACATAATGG - Intergenic
919003209 1:191860911-191860933 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
920174446 1:204091477-204091499 CAGTGCCTTTCACATAATGAGGG - Intronic
921195905 1:212757544-212757566 CAGTGAGCTTTCAATCATGATGG + Intronic
921313308 1:213867144-213867166 CATAGTCTTTCCCATCATGCTGG + Intergenic
922639618 1:227215385-227215407 CAGTGTCCTTGTCATGATCATGG + Intronic
923069551 1:230549981-230550003 AAGTCTCCTCCACATCATGAAGG - Intergenic
924300461 1:242632658-242632680 CAGAGTCCTTGCCTTCATGGAGG + Intergenic
1063700975 10:8385302-8385324 CAGAGTCCTTGCCATAATCAAGG - Intergenic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1068478695 10:57562381-57562403 CTGTGTCCTTCCCTTCAGGATGG + Intergenic
1070412331 10:76153729-76153751 CAATGTCATTCCCTTCATTAGGG + Intronic
1071032885 10:81205771-81205793 CACTGTCCTTTCCATGATGGAGG - Intergenic
1071396139 10:85225901-85225923 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1073047542 10:100649561-100649583 CAGCCTACTTCCCATCATGCAGG + Intergenic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1077740497 11:4840253-4840275 CTGTGTCCTTTCCTTCAGGAAGG - Intronic
1078155090 11:8792815-8792837 CAGTGTACTTCTCATCAGCAGGG - Intronic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1079341647 11:19616623-19616645 CCCTGTCCTCCCCATCATCAGGG - Intronic
1084148943 11:67279137-67279159 CAGAGGCCTTCCCATCATTGTGG - Intronic
1084445731 11:69202535-69202557 CAGTGCCCTGCCCATCAAGCAGG + Intergenic
1085223541 11:74896599-74896621 CAGTGCCCTTCCCTTCAGGTTGG - Intronic
1085981573 11:81732697-81732719 CTGTGTTCTTCCCTTCAGGATGG + Intergenic
1087054304 11:93918636-93918658 CAGCTTCCTGCCCATGATGACGG + Intergenic
1087536776 11:99457256-99457278 CAGTTTCCTTTTCATTATGAGGG - Intronic
1087598310 11:100282652-100282674 CAGTGTCCTTCCTTTCAGGGTGG + Intronic
1087877022 11:103370399-103370421 CTGTGTCCTTCCCTTCAGGTTGG - Intronic
1089229163 11:116955666-116955688 CAGCTTCCTTCCTATCCTGATGG - Intronic
1089980518 11:122768261-122768283 CAGTGTCCTTCCCACCACCACGG + Intronic
1090098918 11:123773300-123773322 GAGTGTCCTGCCCATCCAGAAGG - Intergenic
1090717480 11:129442947-129442969 AAAAGTCCTTCCCATCAGGAAGG - Intronic
1091353180 11:134913955-134913977 CAGTTTCCTTCCCATTGTCAGGG + Intergenic
1091800942 12:3324107-3324129 CAGTGGCCCTTCCATCATGGAGG - Intergenic
1091841848 12:3627191-3627213 CAGTGTCCCTCTCTCCATGAGGG + Intronic
1093526084 12:20104669-20104691 CAGAGTCCTTACCAACAAGACGG - Intergenic
1094347096 12:29482576-29482598 CAGTGTCTTACACATCCTGAGGG + Intronic
1095573538 12:43709534-43709556 CTGTGTCCATCCTTTCATGATGG + Intergenic
1097150816 12:56978685-56978707 CTGTGCCCTTCCCTTCAGGATGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1101542734 12:105679984-105680006 CAGTGTCCTCACCTTCATCAGGG - Intergenic
1101684344 12:107002731-107002753 CAGGGTCCCTCCCATGATGTGGG - Intronic
1105336309 13:19473275-19473297 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106229773 13:27812902-27812924 CCCTGTCCTTCCCATCATTTTGG - Intergenic
1106973309 13:35172948-35172970 CAGAGACTTTCCCACCATGAAGG + Intronic
1108580985 13:51828006-51828028 CAGCCTTCTTGCCATCATGAGGG + Intergenic
1108631607 13:52289180-52289202 CTGTGTCCTTCCCTTCACGATGG + Intergenic
1108655088 13:52523415-52523437 CTGTGTCCTTCCCTTCACGATGG - Intergenic
1108922617 13:55694051-55694073 CTGTGTCCTTCCCTTCATGGTGG - Intergenic
1111668301 13:91297037-91297059 CAGTCTCCTTCCACTCATGGTGG - Intergenic
1112453730 13:99538167-99538189 CAGTGTTCTTTCCACCACGAAGG - Intronic
1112693402 13:101919750-101919772 CAATTTCCTTCCCATCATGAGGG - Intronic
1113569995 13:111346753-111346775 CAGTGTTGTTCCTTTCATGATGG + Intergenic
1115865444 14:37741691-37741713 CAGTCTGCTTCCCACCATTAAGG - Intronic
1116363945 14:44037507-44037529 CAGTGGCCTACCCTTCATGGTGG + Intergenic
1116956702 14:50931283-50931305 CAATGTGCTTCCTATCATCAAGG + Intronic
1117159296 14:52973229-52973251 CTGTGTCCTTCCCTTTATGGTGG + Intergenic
1117513786 14:56479951-56479973 CACTGGCCTTCTCATCAGGATGG - Intergenic
1119363496 14:74071445-74071467 CATGGTCTCTCCCATCATGAGGG + Exonic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1121865658 14:97360032-97360054 TACTTTCCTTCCCATAATGAGGG + Intergenic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1127467400 15:59257686-59257708 CAGTGTTCTTCCCATGCTGTAGG + Intronic
1128301063 15:66566495-66566517 CAGTGCCCTCCCCATCAGAAAGG + Intergenic
1129270677 15:74417795-74417817 CCATCTCCTTCCCACCATGAGGG + Intronic
1131956607 15:97742709-97742731 CTGGTTCCTTCCCATCATGTAGG - Intergenic
1132166748 15:99600282-99600304 CAGTGTCTTATCCTTCATGACGG + Intronic
1132643916 16:990157-990179 CAGGGTCATTCCCATCGTGCAGG - Intergenic
1133273963 16:4625497-4625519 CAATTTCCCTCCCATCAGGACGG + Intronic
1134877675 16:17716453-17716475 AAGTTTCCCTCCCATCATGCAGG - Intergenic
1136369134 16:29825116-29825138 CAGGGTCTCTCCCACCATGAGGG - Intronic
1136620389 16:31424499-31424521 CAATGCCATTCCCATCATCATGG + Exonic
1139974466 16:70797881-70797903 CAGGATGCTTCCAATCATGATGG - Intronic
1140724879 16:77802919-77802941 CAGTTTCCTTCTCACCATCACGG + Intronic
1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG + Intronic
1141117834 16:81325647-81325669 CAGTGTCCTAGGCATCAAGATGG + Intronic
1141508928 16:84500205-84500227 CAGTGTCCTTCAGCTAATGATGG - Intronic
1142562061 17:816048-816070 CCGTGTCCTGCCCCTCCTGATGG - Intronic
1143698679 17:8640543-8640565 CATTATCCTTTCCATCCTGATGG + Intergenic
1144214455 17:13043095-13043117 CAGGAAGCTTCCCATCATGATGG + Intergenic
1144578286 17:16443608-16443630 CAGTCTCCTTGCCCTCATGGTGG + Exonic
1145302002 17:21647423-21647445 CAGGGTCCTTGCCATCACTAAGG - Intergenic
1145328348 17:21850179-21850201 CAGGGTCCTTGCCATCACTAAGG - Intergenic
1145348308 17:22055893-22055915 CAGGGTCCTTGCCATCACTAAGG + Intergenic
1145415273 17:22709469-22709491 CAGGGTCCTTGCCATCACTAAGG - Intergenic
1145695130 17:26781523-26781545 CAGGGTCCTTGCCATCACTAAGG - Intergenic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1147998658 17:44375220-44375242 CGGTGGCCTTCCCATCAGGAAGG + Intronic
1150573064 17:66405064-66405086 CAGTTTCCATCCCATCAAAAAGG - Intronic
1150871107 17:68911513-68911535 CTGTGTCCTTCCCTTTATGGTGG - Intronic
1151214124 17:72565963-72565985 CATTGTCCTCCCCATGCTGATGG - Intergenic
1151571480 17:74928031-74928053 CAGTCTCCATCCCACCAAGAAGG + Intronic
1153595845 18:6724698-6724720 CAGTGTCCCTCACACTATGAGGG - Intergenic
1155341567 18:24819022-24819044 CACTGTCCTTTCCAGCATCAGGG + Intergenic
1156084173 18:33379498-33379520 GAGTGTCCTGCCCATCTAGAGGG - Intronic
1157442298 18:47720159-47720181 CAGTGTCACCCCTATCATGAAGG + Intergenic
1157664554 18:49474902-49474924 CAGAGTCCTTACCAGCAAGAGGG - Intergenic
1157732932 18:50020403-50020425 CAGAGTTCTTCCCATCTTAAGGG - Intronic
1158963845 18:62607096-62607118 CAGAGCCCTTCCCACCCTGACGG - Intergenic
1161129912 19:2581639-2581661 CAGTGTCCTCACCCTCAAGAAGG - Intronic
1161388954 19:4011399-4011421 CAGGGTCCTACCCCTCATGGAGG + Intronic
1162784910 19:13028612-13028634 CAGACTCCTTCCCAGCAGGAAGG - Intronic
1163778653 19:19233424-19233446 CAGTGTCCTTCCCCTCCTTTGGG - Intronic
1163780579 19:19245155-19245177 CACTGTCCTGCCCATCCTGACGG - Intronic
1164100345 19:22049329-22049351 ACGAGTCCTTACCATCATGAAGG - Intergenic
1164646723 19:29863732-29863754 AAGTGTCCTTCCCCTCCTGCTGG + Intergenic
1164871426 19:31647524-31647546 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
925126496 2:1461064-1461086 CCGTGTCCTTCCCACCCAGATGG - Intronic
927594652 2:24385980-24386002 CTGTGTCCTTCCCTTCAGGACGG + Intergenic
927758066 2:25724712-25724734 CAGTGTCCCTCCAATTCTGATGG + Intergenic
928317539 2:30257671-30257693 CTGTGTTTTTCCCATCATGACGG + Exonic
928783659 2:34854982-34855004 CTATGTCCTTCCCTTCATGGTGG - Intergenic
929249401 2:39736186-39736208 CAGTATCCTTCAAAACATGATGG - Intronic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
929847646 2:45547080-45547102 CAGCTTTCTTCCCATCAAGAAGG + Intronic
930032133 2:47064748-47064770 CAATGACCCTCCCACCATGAAGG - Intronic
930550384 2:52827225-52827247 CAGTGCCCTTCTCATAATCATGG + Intergenic
931204005 2:60129515-60129537 CAGTGCCTTTGCCATCATGGAGG + Intergenic
931572346 2:63681612-63681634 CTGTGTCCTTCCCTTCAAGGTGG - Intronic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
933162938 2:79045600-79045622 CTGTGTCCTTCACTTCAGGATGG - Intergenic
936909605 2:117576467-117576489 CATTATCCTTCCAAACATGAAGG + Intergenic
937804979 2:126128827-126128849 CAGTGTCTTATCCTTCATGAGGG - Intergenic
940885836 2:158988602-158988624 CTGTGTCCTCCCCAACACGATGG - Intronic
943237163 2:185337597-185337619 ATGTGTCCTTCCCTTCATGGTGG + Intergenic
943407210 2:187504722-187504744 CAGTGCCCTTCCAGTCAGGAAGG + Intronic
944835131 2:203571756-203571778 CAGTGTCATTCCAATGATGTTGG - Intergenic
945350065 2:208766951-208766973 CAGTGGCATCACCATCATGAGGG + Intronic
946607800 2:221424914-221424936 CTGTGTGCTTTCCATCACGAAGG - Intronic
948268194 2:236654028-236654050 CAATGTCCTTCCCAAGATGAAGG + Intergenic
1171518586 20:25758825-25758847 CAGGGTCCTTGCCATCATTAAGG - Intergenic
1171558270 20:26097384-26097406 CAGGGTCCTTGCCATCACTAAGG + Intergenic
1175966021 20:62660663-62660685 CAGTGTTCTTCCCATCTGGGTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176737241 21:10561812-10561834 CTGTGTCCTTGCCTTCAGGATGG - Intronic
1178901565 21:36603053-36603075 CAGTTTCCTTCCCATCTGAAAGG - Intergenic
1180563245 22:16639363-16639385 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1180873502 22:19162059-19162081 AAGTCTCCTTCCCATGAGGAAGG - Intergenic
1182040655 22:27236680-27236702 CAGTGGTCTCCCCATCATGCTGG - Intergenic
1183531883 22:38360781-38360803 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1183620043 22:38966925-38966947 CAGTGTCCCTGCCATCTTGGTGG - Intronic
1184287452 22:43479550-43479572 CAGTGAGCTGCCCATCACGAGGG + Intronic
949638429 3:6009855-6009877 CAGTGTCCCTAGCTTCATGAGGG - Intergenic
950884292 3:16349094-16349116 CATTTCCCTTCCCATAATGATGG - Intronic
951032153 3:17894975-17894997 CTGTGTCCTTCCTTTCATGGTGG + Intronic
951069505 3:18310116-18310138 CAGTGTGATTCCTTTCATGAGGG + Intronic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG + Intronic
951736794 3:25874985-25875007 GTGTCTCCTTCCCATCAGGATGG + Intergenic
951819279 3:26790704-26790726 CTGTTTCCTTCCCTTCAGGATGG + Intergenic
952542313 3:34379256-34379278 CAGAGTCCTACCCAACAAGAAGG + Intergenic
952639855 3:35580154-35580176 CTGTGTCCTTACCTTCATGGTGG - Intergenic
953473846 3:43189454-43189476 CAGTTTCCTTCCCCTCACCATGG - Intergenic
954367083 3:50151926-50151948 GAGTGTCCTACCCAACAGGAGGG + Intergenic
954626253 3:52023557-52023579 TAAGGTCCTTCCCAGCATGATGG - Intergenic
955721024 3:61881468-61881490 CAGCGTCCAGCACATCATGAAGG - Intronic
957728895 3:84106395-84106417 CAGTATCTTTTCCATGATGATGG + Intergenic
959042003 3:101432367-101432389 CTGTGTTCTTCCCTTCAGGATGG - Intronic
963846580 3:150164829-150164851 CAGCGTCCAGCACATCATGAAGG + Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
967144286 3:186593067-186593089 CAGTGTCCTCACCAACAGGAAGG + Intronic
968149567 3:196326305-196326327 CAGTGGGCTTCCCAACATGTGGG + Intronic
971582518 4:28360936-28360958 CAGTGTCAAGCCCAGCATGAAGG + Intergenic
973594593 4:52473866-52473888 AATTTTTCTTCCCATCATGATGG + Intergenic
974125192 4:57687621-57687643 CAGGCTGCTTCCAATCATGATGG + Intergenic
974569120 4:63621346-63621368 CAAAGTTCTTGCCATCATGAAGG + Intergenic
974936926 4:68420025-68420047 CAATGTATTTCCCATAATGAAGG - Intergenic
975313059 4:72925082-72925104 TAGTGTCCTTCCCTTCAGGATGG + Intergenic
976330197 4:83822723-83822745 CAGTTTCATTCCCACCATAAGGG - Intergenic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
982079041 4:151769614-151769636 CAGTGTCCTTCCAATTCTCAGGG + Intergenic
982720458 4:158854534-158854556 CCGTGCCCTCCCCATCATAAGGG + Intronic
985362679 4:189192474-189192496 CAGGGAGCTTCCAATCATGAAGG + Intergenic
986483372 5:8211575-8211597 CAGTGCCCCTTCCATCATGGGGG - Intergenic
988056713 5:26106431-26106453 CAGTGTCCTTGGCTTCATCAGGG + Intergenic
988698623 5:33649666-33649688 CATTTTCTTTCCCATCATGCTGG + Exonic
992133211 5:73716277-73716299 CAGTGTCCATGCCAGCATGAAGG + Intronic
993191159 5:84683761-84683783 CAGTGTTCTTCCCCTCCAGAGGG - Intergenic
993951810 5:94185075-94185097 CAGTCTTCTTCACAGCATGATGG + Intronic
994011029 5:94902441-94902463 CAATGTTCTGCCAATCATGATGG - Intronic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
995096346 5:108239972-108239994 CAAGGTCCTTCCCTTCAAGATGG - Intronic
996161702 5:120174268-120174290 CTATGTCCTTCCCTTCATGGAGG - Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
1003513258 6:6799167-6799189 CAGTGTCCCTACCAGCAGGAAGG - Intergenic
1006130893 6:31868944-31868966 CAGTTTCCCTCCCCACATGATGG + Intronic
1006227697 6:32554309-32554331 CAGTGACCTTCCTGACATGAGGG - Intronic
1006440448 6:34050488-34050510 CCGTCTCCCTCCCACCATGACGG + Intronic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1006628518 6:35414630-35414652 CTGTGTCCTACCCAGCCTGAGGG + Intronic
1008945499 6:57091843-57091865 CAGTTTCTTTCCCAGCATTAGGG + Intronic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010407093 6:75517893-75517915 CATGGTCTTTCCCATCATAATGG + Intergenic
1010658388 6:78540107-78540129 TAATGTCCTTTCCATCATGGAGG + Intergenic
1012050002 6:94329120-94329142 CTGTGTCCTTCCCTTCACGTTGG - Intergenic
1012555120 6:100502194-100502216 CACTGCCCTTCTTATCATGACGG + Intergenic
1012717712 6:102698510-102698532 CTGTGTCCTTCCCTTCTGGATGG + Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1017294210 6:152775572-152775594 AAGTGTCATTCCCATCCTGCTGG + Intergenic
1018286407 6:162243849-162243871 CTGTTTCCTTCCAATCATGAAGG + Intronic
1021353809 7:19628713-19628735 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1021782683 7:24121172-24121194 CTGGGTCCATCCCATCCTGAGGG - Intergenic
1022105830 7:27197335-27197357 GAGTTTCCATCCCAACATGATGG - Exonic
1023229669 7:38013377-38013399 CCATTCCCTTCCCATCATGAGGG + Intronic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1024991013 7:55234537-55234559 CAGAGTCCAACCCATCAGGAAGG + Intronic
1026797736 7:73377101-73377123 CAATGACTTTCCCAACATGATGG + Intergenic
1027179525 7:75928528-75928550 CAATCTTCTTCCCATCAGGACGG + Intronic
1027869979 7:83694726-83694748 CTGAGTTCTTCCCCTCATGAAGG + Intergenic
1028264381 7:88705207-88705229 CTGTGTCCTTCCTTTCAGGATGG + Intergenic
1028521920 7:91741827-91741849 TAGTGTCCTTCCCTTAAAGATGG + Intronic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030318245 7:108138187-108138209 CTGTGTCCTTCCCATCTCTATGG + Intergenic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031254833 7:119434567-119434589 CAGTTTCCTTCCAATCATGGTGG + Intergenic
1032972009 7:137175154-137175176 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1033817157 7:145086302-145086324 CTCTTTCCTTCCCATCATAAGGG - Intergenic
1036616371 8:10390713-10390735 CAGTGCCCATCCCCTCATCAGGG - Intronic
1039468594 8:37800101-37800123 CTGTCTCCTCCCCATCAGGAAGG + Intronic
1043326200 8:79054928-79054950 CAGTGCCTTTCCCATTATCAAGG + Intergenic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1050578657 9:7027659-7027681 TTGTGTCCTGCCCTTCATGATGG + Intronic
1050741930 9:8830623-8830645 CAGTGTCCACCCTATCATGAGGG + Intronic
1050865114 9:10488524-10488546 CTGTGTCCTTCCATTCAGGATGG + Intronic
1051101314 9:13525218-13525240 CAGTGTCATTCCCACCATCAGGG - Intergenic
1051455070 9:17246614-17246636 CTGTGTCCTTCCCTTCAGTACGG + Intronic
1051839576 9:21380000-21380022 CTCTTTCCTTCCCATCATAAGGG + Intergenic
1052063393 9:23987548-23987570 CTGTGTCTTTCCCTTCAGGATGG - Intergenic
1052258714 9:26490659-26490681 CTGTGTCCTTCCCTTCAAGATGG + Intergenic
1057713204 9:97465903-97465925 CAGTGTCCTTCCCATCATGAAGG - Intronic
1059354575 9:113688652-113688674 CAGTGTACTTGACACCATGAAGG - Intergenic
1203630462 Un_KI270750v1:68769-68791 CAGAGTCCTTGCCATCACTAAGG - Intergenic
1188366661 X:29324215-29324237 CCCTTTCCTTCCCATCATAAGGG + Intronic
1188569821 X:31570793-31570815 CATTTTCCTTCCCAGCATGCTGG - Intronic
1189395142 X:40614686-40614708 CAGGGTCGTTCCCATCAAGCAGG + Intergenic
1190446784 X:50533604-50533626 CAGGATGCTTCCAATCATGATGG - Intergenic
1190904705 X:54715514-54715536 CAGGGTCCTTCCCAACATATAGG - Intergenic
1191097998 X:56694889-56694911 CAGTCTGCTTCCACTCATGATGG + Intergenic
1192234981 X:69289912-69289934 CAGTGTCCCTCACAGCATGGGGG - Intergenic
1192714693 X:73627373-73627395 CTATGTCCTTCCCTTCAGGATGG + Intronic
1194193498 X:90865268-90865290 CAGTCTCCTTCGCACCATCAGGG - Intergenic
1194218836 X:91167091-91167113 CATTCTCCTTCCCTTCATGGTGG + Intergenic
1194323122 X:92477167-92477189 CTGTGTTCTTCCCTTCAAGATGG + Intronic
1194568510 X:95523021-95523043 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196047997 X:111276205-111276227 CACTGTCTCTCCCATCATGGAGG - Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196479855 X:116135572-116135594 TTGTGTCCTTCCCATCAAGGTGG + Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197600448 X:128520841-128520863 CTATGTCCTTCCCTTCAGGACGG - Intergenic
1198841105 X:140859033-140859055 CTGTGTCCTTCCCTTCGTGGTGG - Intergenic
1199854337 X:151747893-151747915 CAATGTCCATCCCATGATGTGGG - Intergenic
1200555345 Y:4630845-4630867 CATTCTCCTTCCCTTCATGGTGG + Intergenic
1200631221 Y:5590324-5590346 CTGTGTTCTTCCCTTCAAGATGG + Intronic
1202595511 Y:26535115-26535137 CTGTGTCCTTCCCTTCAGGATGG - Intergenic