ID: 1057719966

View in Genome Browser
Species Human (GRCh38)
Location 9:97524251-97524273
Sequence TCCTCAGCTCTTCCTCTGTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057719966_1057719972 21 Left 1057719966 9:97524251-97524273 CCTAACAGAGGAAGAGCTGAGGA 0: 1
1: 0
2: 1
3: 28
4: 301
Right 1057719972 9:97524295-97524317 AGCTGGACCCTGATGTGAGTAGG 0: 1
1: 0
2: 1
3: 21
4: 125
1057719966_1057719971 4 Left 1057719966 9:97524251-97524273 CCTAACAGAGGAAGAGCTGAGGA 0: 1
1: 0
2: 1
3: 28
4: 301
Right 1057719971 9:97524278-97524300 GGAAAATGAGCTGGATGAGCTGG 0: 1
1: 0
2: 4
3: 34
4: 707
1057719966_1057719975 30 Left 1057719966 9:97524251-97524273 CCTAACAGAGGAAGAGCTGAGGA 0: 1
1: 0
2: 1
3: 28
4: 301
Right 1057719975 9:97524304-97524326 CTGATGTGAGTAGGTGCTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1057719966_1057719968 -5 Left 1057719966 9:97524251-97524273 CCTAACAGAGGAAGAGCTGAGGA 0: 1
1: 0
2: 1
3: 28
4: 301
Right 1057719968 9:97524269-97524291 GAGGACCCTGGAAAATGAGCTGG 0: 1
1: 1
2: 0
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057719966 Original CRISPR TCCTCAGCTCTTCCTCTGTT AGG (reversed) Exonic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
902462955 1:16592891-16592913 TCCAGAGCTCTTCCTCTATGTGG + Intronic
902804568 1:18852888-18852910 TCCTCATCTCCTCCTAGGTTGGG + Intronic
903158564 1:21467841-21467863 TCCAGAGCTCTTCCTCTATGTGG - Intronic
904503456 1:30931176-30931198 TCCTCCGCGTTTCCTCTGTTTGG - Intergenic
904999865 1:34659641-34659663 TCCTCAGCCCTGCCTCTGGCCGG + Intergenic
905246336 1:36616925-36616947 TTCTCAGCTCTTTTTGTGTTTGG - Intergenic
906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG + Intronic
908945792 1:69495000-69495022 TCTTCAGGTCTTCCACTGCTTGG + Intergenic
909020874 1:70429271-70429293 TACTCAGCCCTTCCTATGTGTGG - Intronic
913569117 1:120102692-120102714 CCCTCAGCTATGCCTCAGTTTGG - Intergenic
913640118 1:120804698-120804720 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
913991060 1:143612286-143612308 TCCAAAACTCTTCCTCTGTGTGG + Intergenic
914212394 1:145591930-145591952 TCCAAAGCTCTTCCTCTATGTGG + Intergenic
914278356 1:146145639-146145661 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914289926 1:146263683-146263705 CCCTCAGCTGTGCCTCAGTTTGG - Intergenic
914539403 1:148596587-148596609 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914550969 1:148714466-148714488 CCCTCAGCTGTGCCTCAGTTTGG - Intergenic
914627276 1:149475041-149475063 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914871450 1:151478344-151478366 GCCACAGCCCTTCCTCTCTTAGG + Intergenic
914940389 1:152017763-152017785 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914963567 1:152229634-152229656 TCCTTAGCTCTTTGCCTGTTTGG + Intergenic
915680029 1:157572475-157572497 TCCTGAGATCTTCCTCAGTAAGG - Intergenic
916703277 1:167320128-167320150 TCGTCAGCTGCTCATCTGTTTGG + Intronic
918109438 1:181442570-181442592 ACCTCCCCACTTCCTCTGTTGGG + Intronic
920420484 1:205829978-205830000 ATCCCAGCTCTTCCTCTCTTTGG - Intronic
921790708 1:219287182-219287204 TCCTCACCTCTTCCTGCATTCGG - Intergenic
923671148 1:236042353-236042375 TCCTCAGGGCTCCCTCTGCTTGG - Intronic
924154819 1:241164993-241165015 TCCTCAGCTGATCCTGTGTAAGG + Intronic
924747968 1:246855601-246855623 TCCTCAGTTATTCCTCTCTCTGG - Intronic
1064143861 10:12812112-12812134 TCCTCAGCTGTTCCTCCCGTGGG - Intronic
1064144042 10:12813462-12813484 CCATCAGCTCATCCTCTGTTAGG + Intronic
1064789665 10:18942430-18942452 TCCTCATCTGTTCTTCTGCTTGG + Intergenic
1067511193 10:46896174-46896196 TCCTCAGGTCTCTCTCTTTTGGG + Intergenic
1067651060 10:48155688-48155710 TCCTCAGGTCTCTCTCTTTTGGG - Intergenic
1069509677 10:69032561-69032583 TCATTAGTTCTTCATCTGTTTGG + Intergenic
1069757587 10:70782592-70782614 GCGTCAGCTCTTCCTCTCCTAGG - Intronic
1072472938 10:95731333-95731355 TCCTCAGCTCCTTCCCTGCTGGG + Intronic
1072549892 10:96469484-96469506 GCCTCTGCTCTGCCTCTGGTGGG + Intronic
1074446475 10:113525181-113525203 TCCCCAGCTCCTCATCAGTTGGG - Intergenic
1074610635 10:115017677-115017699 ACCTCAGCTCTTCTTTTTTTTGG - Intergenic
1076181409 10:128411766-128411788 TCCTCTGCTCCTCCTCTTTCTGG - Intergenic
1078887939 11:15524045-15524067 TCCTTAGTTTTTCCTCAGTTTGG - Intergenic
1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG + Intronic
1079222808 11:18578772-18578794 TCCTTAGTTCTTCCACAGTTAGG + Exonic
1079478395 11:20856082-20856104 TGCTCAGCTATTCCTCTTTTAGG + Intronic
1080099226 11:28439979-28440001 TTGTCAGCTGTTCCTGTGTTGGG + Intergenic
1085436990 11:76514517-76514539 TCCCCAGTTCTGCCTCTTTTTGG - Intronic
1085444158 11:76589615-76589637 TCCTCTGCTCTCGCTCTGGTGGG - Intergenic
1086545331 11:87961211-87961233 TCCTCAGCTTTTACTCTGGCTGG - Intergenic
1088218942 11:107546497-107546519 CCCTAAGCTCATCCTCAGTTAGG + Intronic
1088973952 11:114798332-114798354 TCTTCATCTCTTTCTCTCTTTGG + Intergenic
1089221871 11:116878814-116878836 TCCTCAGATCTTCATATGATTGG + Intronic
1089416475 11:118296307-118296329 GCCCCAGCACTTCCTCAGTTGGG - Intergenic
1090158969 11:124471232-124471254 TCTTGAGCTTTTCCTTTGTTTGG - Intergenic
1090575682 11:128100495-128100517 GCCTCAGTCCTTTCTCTGTTGGG + Intergenic
1091011655 11:132006859-132006881 TCCTGAGCACTTCCTGTGGTAGG + Intronic
1091237674 11:134032883-134032905 TGCTTAGCTCTTCCTCGGGTGGG + Intergenic
1091920836 12:4303331-4303353 TCCTTAGCTCTTAGTCTCTTTGG + Exonic
1092644852 12:10559363-10559385 GCTGCAGCTCTTCCTCTGGTGGG - Intergenic
1093999924 12:25684006-25684028 TCTTCCCCTCTTCCTCTGTCTGG + Intergenic
1094023889 12:25942293-25942315 TCCTCAGTTCTTCCCCTATTGGG + Intergenic
1095535213 12:43238001-43238023 GCCTCAGCTCTTTCTTTGATAGG - Intergenic
1096235805 12:49925671-49925693 TACCCAGCCCTTCCTCTCTTGGG + Intergenic
1096326229 12:50664524-50664546 ACCTCAGCTCTTTCTTTGTAGGG + Intronic
1096636162 12:52960940-52960962 TCCTCAGCTTTTTCTCTTCTTGG + Intergenic
1096966476 12:55631972-55631994 TCCTCTTCTCTTCCTGTTTTTGG - Intergenic
1098803446 12:74990928-74990950 TACTCAGCTCTTATTCTGTGTGG - Intergenic
1103260545 12:119584833-119584855 TCCTCAGCTCTTCAAATGTCTGG + Intergenic
1103724781 12:122992164-122992186 TCCTTAGCTCTGTCTCTGTTGGG + Intronic
1104103658 12:125639007-125639029 CCCTCAGCTCTTCTTATATTAGG + Intronic
1104495149 12:129230238-129230260 TCCTCAGCTCCTTCTGTGTAGGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105780683 13:23702862-23702884 ACCTCACCCCTTCCTCTGCTGGG - Intergenic
1106652767 13:31709519-31709541 ACCACAGCACTTCCTCCGTTTGG - Intergenic
1108123492 13:47215064-47215086 TCCCCTGCTTGTCCTCTGTTGGG - Intergenic
1110365740 13:74683337-74683359 TCCTCAGCTCTGCTCATGTTTGG + Intergenic
1110487516 13:76064585-76064607 TCCCCAGCTCTTACTGTATTGGG + Intergenic
1113288795 13:108883109-108883131 TCCTCACCTCTTCTCCTGTGTGG + Exonic
1113935216 13:113990337-113990359 GCTCCAGCTCTTCCTCTGCTGGG - Intronic
1115521900 14:34241412-34241434 GCCACAGCTCTTCCTCTCCTGGG + Intronic
1116633024 14:47357647-47357669 ACCTGGGTTCTTCCTCTGTTGGG + Intronic
1118270276 14:64337010-64337032 CCCTCAGCTCATCTTCTGGTGGG - Intronic
1118504840 14:66399935-66399957 TCATCAGGTCTTCCTCAGTAAGG + Intergenic
1120796375 14:88637469-88637491 TCCTTTGCTCTCCCTCTGTTAGG - Intronic
1123909622 15:24954625-24954647 CCCTCAGGTCTTCCTATGTGCGG - Intronic
1124808391 15:32908898-32908920 CCCCCATCTCTTCCTCTGTAAGG + Intronic
1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG + Intergenic
1125966759 15:43881054-43881076 GCCTCAGCCCTCCCTCTTTTGGG + Intronic
1126069170 15:44850757-44850779 GAGTCAGCTCTTCCTCAGTTAGG - Intergenic
1126089641 15:45040016-45040038 GAGTCAGCTCTTCCTCAGTTAGG + Intronic
1126753950 15:51906033-51906055 TCCTCAGCTCATCCTCTAGATGG - Intronic
1127563663 15:60165471-60165493 TCCCCAGCTCTGCCTGTGATAGG - Intergenic
1127593186 15:60448445-60448467 TCCTCAGCTCTGCCTAGATTAGG - Intronic
1127991318 15:64120199-64120221 TTCTCAACTCTTGGTCTGTTTGG + Intronic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1129657233 15:77532307-77532329 TCCCCAGCCCTGCCTCTCTTAGG + Intergenic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130771079 15:86924554-86924576 TTCTCAGCTTATTCTCTGTTTGG + Intronic
1131969083 15:97874416-97874438 TGCTGGGCTCTGCCTCTGTTGGG + Intergenic
1132929847 16:2453504-2453526 TCCTCAGCTCTCCCTCGGGGCGG + Exonic
1133115822 16:3577407-3577429 TCCTCACCTCTTCCTGTGCTGGG + Intergenic
1133136107 16:3713251-3713273 CCCTCTGCTCTCCCTTTGTTTGG - Intronic
1133939581 16:10297195-10297217 ACCTTAGGTCTTCCTCAGTTCGG + Intergenic
1134844277 16:17426707-17426729 TACTCAGCTCTGCCATTGTTGGG - Intronic
1136153302 16:28366015-28366037 TCCTCCAGTCTTCTTCTGTTTGG - Intergenic
1136209784 16:28749252-28749274 TCCTCCAGTCTTCTTCTGTTTGG + Intergenic
1136406606 16:30051804-30051826 TCCTCAGTTTTGCCTCTGTGAGG - Intronic
1137509612 16:49087457-49087479 TCCTCTGCTCTTCCTTCCTTGGG - Intergenic
1137896568 16:52219169-52219191 TCCTCAATTCTGCCACTGTTGGG - Intergenic
1138333114 16:56231061-56231083 TCCTCATCTCTTCCTGTCTTTGG - Intronic
1138527883 16:57619537-57619559 ACCTCAGTTCTCCCTCTGTCAGG + Intronic
1138694917 16:58804127-58804149 TCCTCAGTCCTTTCTCTTTTGGG - Intergenic
1139046188 16:63062409-63062431 TACTCAACTCTGCCTCTGTGGGG - Intergenic
1139472345 16:67184901-67184923 TCAGCAGCTTTTCCTCAGTTTGG - Exonic
1141819779 16:86437297-86437319 TCCTCAGATCATGCTCTATTCGG - Intergenic
1142789521 17:2253052-2253074 TACTCAGCTCTGCCTTTGTAGGG - Intronic
1143438421 17:6948802-6948824 TCATCATCTCATCCTGTGTTTGG - Intronic
1144155515 17:12496673-12496695 CTCTCATCTCTTCCTCTCTTTGG + Intergenic
1144173473 17:12682275-12682297 TCCTCTGCTCTTCCTGTGCATGG - Intronic
1145269504 17:21397128-21397150 TCCCCAGCTCTGCCTCTTATAGG + Intronic
1145883848 17:28369567-28369589 TGCACAGCTCCTCCTCTGCTGGG + Exonic
1147342892 17:39765389-39765411 TGGTCAGCTCTTCCTCTTTGTGG + Exonic
1147878736 17:43640539-43640561 TCCACAGCTCTTGCCCTTTTTGG + Exonic
1148069466 17:44899602-44899624 TCCTCAGCTCTCACCCTCTTTGG - Exonic
1148097522 17:45063349-45063371 TTCTCAGCTCTTCCATTTTTAGG - Intronic
1149094295 17:52822041-52822063 TCTTCAGTTCTTCATCTTTTAGG + Intergenic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1152113484 17:78370424-78370446 TCCTCATCTCTTCCAGTTTTAGG + Intergenic
1152585620 17:81188274-81188296 TCCTCAGCTCCTCCTGGCTTGGG + Intergenic
1152830759 17:82495837-82495859 TCCCCAGCTCTTTCTCTGCCTGG - Intergenic
1153182501 18:2450874-2450896 TCCTCAACTCCTCCTTTCTTCGG + Intergenic
1153438898 18:5095432-5095454 TCCTCATTTCTTCCTCATTTTGG - Intergenic
1156645842 18:39161726-39161748 ACCTCAGCCCTTCATCTGTGGGG - Intergenic
1157306147 18:46519061-46519083 ACCTCGGTTCTTCCTCTGTGAGG + Intronic
1160600534 18:80009297-80009319 GCCTCAGTTATTGCTCTGTTGGG + Intronic
1160695797 19:483720-483742 CCATCAGCTCTTCCTCTCATGGG + Intergenic
1162084145 19:8238321-8238343 TCCCCTGCTCTTCCTATGCTAGG - Intronic
1163495247 19:17642769-17642791 TGCCCAGCTCTTCCTCTTTCTGG - Intronic
1164464243 19:28473972-28473994 TTCCCAGCTCTTCCTGTCTTGGG - Intergenic
1166730683 19:45057488-45057510 TCCCCAGCCCTGCCTTTGTTGGG - Intronic
1167051798 19:47083958-47083980 TCCTCCCCTCCTCTTCTGTTTGG + Intronic
1168250317 19:55137868-55137890 GCCTCAGCCCCTCCTCCGTTAGG + Intronic
1168612015 19:57808806-57808828 TCCTCAACACTCCCTCTGTAGGG + Exonic
1168616459 19:57841113-57841135 TCCTCAACACTCCCTCTGTAGGG - Exonic
1168620397 19:57874929-57874951 TCCTCAACACTCCCTCTGTAGGG + Exonic
1202678616 1_KI270711v1_random:30323-30345 TCCAGAGCTCTTCCTCTATGTGG + Intergenic
925072944 2:985493-985515 TCCCCAGCTCCCCCTCTGCTGGG + Intronic
926430189 2:12777788-12777810 TCCTGGACTCTTCCTCTGTTTGG - Intergenic
928138958 2:28710991-28711013 TCCTCTGCCCTTGCTATGTTCGG - Intergenic
928375593 2:30770712-30770734 TCCTCAGCGTTGCCTCTCTTTGG + Intronic
929010771 2:37441841-37441863 TCCACATCTCTTCCTCTGGCTGG + Intergenic
930775060 2:55162941-55162963 TCCTCACCCCTTCCTTTCTTTGG + Intergenic
932462969 2:71895362-71895384 TCCTCAGCTCTTCTGCTGTGAGG - Intergenic
932888312 2:75567886-75567908 TTATTAGCTCTTCTTCTGTTAGG - Intronic
933242496 2:79938138-79938160 TTCTCAGCTCCTCCTTGGTTGGG - Intronic
933249028 2:80007814-80007836 TCCTCACCTCCTCCAATGTTGGG - Intronic
936953605 2:118002707-118002729 TCTTCACCCCTTCCTCTGTTAGG - Intronic
939428429 2:142071627-142071649 TACTCAACTTTGCCTCTGTTGGG - Intronic
941674411 2:168328556-168328578 TCCTCAGATCTAGCGCTGTTGGG - Intergenic
946180860 2:217948225-217948247 TCCCCAACTCTTCCTGTGATGGG + Intronic
947277446 2:228408770-228408792 TCCTCAGCTTCTTGTCTGTTGGG - Intergenic
947506392 2:230711520-230711542 TCCTCATCTCTTCCCCTATCTGG + Intergenic
948334689 2:237198758-237198780 TCCTGAGCTCTGCCTCTTATCGG - Intergenic
948692244 2:239713710-239713732 TCCTCTGCTCTTTTACTGTTGGG + Intergenic
1169437246 20:5603495-5603517 TCCTCCTTTCTTCCTCTTTTAGG - Intronic
1169887216 20:10413055-10413077 TACTCAGATCCTCCTTTGTTTGG - Exonic
1170496149 20:16927429-16927451 TCCTTAGCTCTTCCTCACATTGG + Intergenic
1170510629 20:17072837-17072859 TCCTCAGTTCTTCCAGGGTTTGG + Intergenic
1170588980 20:17756837-17756859 GCGTCAGCACTTCCTCTGCTTGG + Intergenic
1170939720 20:20838775-20838797 TCCTCTCTTCTTCCTCTCTTAGG + Intergenic
1171040687 20:21759757-21759779 TCCACAGGTCTTCCTCTCTCAGG - Intergenic
1171456353 20:25274910-25274932 TGCTCAGCGCTTCCACTGTTTGG - Intronic
1173183841 20:40824215-40824237 TTCTCAGCTCTCCCACTGCTGGG - Intergenic
1173217034 20:41094606-41094628 TTCTCAGCTGGTCCTCTGCTGGG + Intronic
1173443335 20:43096594-43096616 TCCACAGCTCTGCCTGTGTAAGG + Intronic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1174856612 20:54051448-54051470 TCCTGAGGTCTCCCTCTCTTGGG + Intronic
1175469614 20:59218176-59218198 TTCTCAGCCCTTCCTGGGTTAGG + Intronic
1178181098 21:30162432-30162454 TCCTCAGCTCCACCTGAGTTAGG + Intergenic
1178323416 21:31623544-31623566 TTATGAGCTCTTCCTCTGTGAGG - Intergenic
1178486931 21:33025388-33025410 TCCCTAGCTCTTCCTCTGTCTGG - Intergenic
1178976193 21:37223133-37223155 TCCTCATCTCTTGCTCTAATTGG + Intergenic
1179352497 21:40625869-40625891 TCCTCACCTCTTCCTCCTCTCGG + Intronic
1180246124 21:46548420-46548442 TCCTCAGCTCTTCCCTAGTGGGG - Intronic
1181559036 22:23689051-23689073 TTCTCTGGTCTTCCTCTGATAGG - Intronic
1182243916 22:28939992-28940014 TCCTCAGGTCTTTCACTGTGAGG + Intronic
1183774105 22:39951692-39951714 TTCTCATCTCTCCATCTGTTCGG - Intronic
1184262525 22:43327410-43327432 TCTTCAGCCCTTCCAGTGTTAGG - Intronic
950891979 3:16412390-16412412 CCTTCAGCTCTTCCTCTGTGAGG - Intronic
951106418 3:18748755-18748777 TCCTCATTTCTTCCTCAATTAGG + Intergenic
951574641 3:24101308-24101330 TTCTCATCTCTTCCTCTGAAGGG + Intergenic
951765922 3:26198947-26198969 TCTTCAGCTGTTCATCTTTTTGG + Intergenic
953957597 3:47243774-47243796 TCCTCAGATCTGCCTCTTCTCGG - Intronic
954274913 3:49535865-49535887 TCCTCAGTTCCTCCTCTGTAAGG + Intergenic
954391650 3:50270797-50270819 TCCTCACCCCTCCCTCTCTTCGG - Intronic
956323527 3:68025687-68025709 TCATTGGCTCTTGCTCTGTTTGG + Intronic
956605967 3:71073356-71073378 TCCTCACCTCTTCCTGCCTTGGG + Intronic
957119567 3:76072714-76072736 CCCTCAGCTCTTGATCTGTGAGG - Intronic
957242369 3:77675328-77675350 TCTTCAGCTTTTTCACTGTTGGG + Intergenic
960703907 3:120463622-120463644 ACCTTAGCTCTCCCTCAGTTGGG - Intergenic
962499048 3:135970697-135970719 CCCTCACCACTTCCTCTTTTTGG - Intronic
962528705 3:136258679-136258701 GCCTCACCTTTTCCTCTTTTAGG + Intronic
962983304 3:140509781-140509803 CCGTCAGCTCTACCTCTGTGGGG + Intronic
964677576 3:159300789-159300811 TCCTCCTCTCTCCCTCTGTGGGG + Intronic
965421160 3:168460347-168460369 GCCTCACCTCTACCTCTGTTAGG + Intergenic
965681914 3:171260403-171260425 TCCCCAGGTTTTCATCTGTTAGG - Intronic
966272815 3:178128865-178128887 TCCCCAGCTATTCCGGTGTTTGG - Intergenic
966301221 3:178481459-178481481 TCCTTAGCTCTTGGTCTATTTGG - Intronic
969840486 4:9878045-9878067 CCCTCTCCTCTTCCTCTGTGGGG + Intronic
970618818 4:17796069-17796091 TCCTCAGTTCTAAGTCTGTTTGG + Intergenic
972108804 4:35528205-35528227 TTCTCAGCTCCTTCTGTGTTTGG + Intergenic
972727503 4:41758086-41758108 TCCTCAGCTCTGTCTCTGCAAGG - Intergenic
972739833 4:41878892-41878914 TCCCCAGCTCTTTCTATTTTGGG + Intergenic
974922693 4:68261552-68261574 TCCTCAGCTCTTTGCATGTTTGG + Intergenic
975118018 4:70700674-70700696 CTCTCAACTCTTCCTATGTTAGG - Intergenic
976717796 4:88141499-88141521 TCCAGGGCTCCTCCTCTGTTAGG - Intronic
979508440 4:121524758-121524780 TCCTTACCTCTTCCTGGGTTGGG - Intergenic
979670332 4:123354551-123354573 TCCTGAACTCTTCCTGTGTCTGG + Intergenic
982500295 4:156145997-156146019 TACTGAGCTCTTTCTCTGTTAGG - Intergenic
983539876 4:168897891-168897913 TCCTCAGCTCTGCAGCTGTTAGG - Intronic
983695467 4:170523746-170523768 ACCTCAGCTCTTCCTCTCACTGG + Intergenic
984849724 4:184143354-184143376 GCCTCAGCTCTTCCTATGAGTGG - Intronic
985615139 5:915660-915682 TCCTCAGCTCCTGCTCTGGGAGG - Intronic
986215069 5:5712581-5712603 TCCTCTGCTCTTCCTCAGAGGGG + Intergenic
988207481 5:28158714-28158736 TCCTCAGGAATTCCTCTTTTAGG + Intergenic
988445971 5:31286580-31286602 GCCTCTGCTCCTCCTCTCTTTGG - Intronic
989446285 5:41533515-41533537 TCATCCCCTCTTCCTCTGTGGGG + Intergenic
990352296 5:54930993-54931015 TCCTTAGCTCTCTCTCTGGTGGG - Intergenic
991617699 5:68514303-68514325 TCATCAGTTCTTCCTCTGAAAGG + Intergenic
992557195 5:77915625-77915647 TCTTCAGCACTTCCACTGCTGGG + Intergenic
995013842 5:107288165-107288187 CCCTCAGCTCTGCCTCTGGATGG + Intergenic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
995376936 5:111484349-111484371 TCTTCAGCTTCTCCTCTGCTAGG - Exonic
997254392 5:132417272-132417294 TGGTCAGCTCTTCCCCTGCTGGG + Intronic
997283938 5:132665099-132665121 TCAGCAGCTCTGCCTCTCTTGGG + Intergenic
997322207 5:132987890-132987912 TCCTCATCTCTTCTTTCGTTCGG + Intergenic
997792761 5:136776676-136776698 TTCTCAGTTGTTCCTCTGCTGGG + Intergenic
998727999 5:145041130-145041152 TCATTAGCTGTTCTTCTGTTTGG - Intergenic
998885327 5:146688005-146688027 ACGTCAGCTCATTCTCTGTTTGG + Intronic
999823393 5:155250849-155250871 TTTACAGCTCTTCCCCTGTTTGG + Intergenic
999887606 5:155940085-155940107 GCCTCAGCTTTTCATGTGTTGGG + Intronic
1000287734 5:159841866-159841888 TACTCAGATTTTCCTCTTTTGGG - Intergenic
1001002183 5:168017996-168018018 GCCTCTGCACTTCCACTGTTGGG + Intronic
1001034768 5:168290005-168290027 CCCTCTACACTTCCTCTGTTTGG - Intergenic
1003251604 6:4433282-4433304 TTTTCAGCTCTTCCTCTGGATGG + Intergenic
1003521110 6:6859310-6859332 TTCTCAGCTCCTCCTCTGAGTGG + Intergenic
1005155690 6:22803606-22803628 TCCTCTGCTTTTCCTCTGTTAGG - Intergenic
1006337342 6:33427679-33427701 TCCTGGGCTCCTCCTCTGCTGGG + Intronic
1006732166 6:36244494-36244516 TACTCAACTCATCCTCTATTTGG + Intronic
1007123492 6:39402925-39402947 GCCACAGCTTTTCCTCAGTTTGG - Intronic
1007728741 6:43932988-43933010 TCCTCGGCATTTCCTCTGTGTGG + Intergenic
1009408110 6:63333261-63333283 TCCTCAGCTTTTTCTGTGTTGGG - Intergenic
1010067197 6:71696698-71696720 TCCTTCTCTCTTCCTCTGTGAGG - Intergenic
1017657048 6:156639962-156639984 TCCTCAACTCTTCTTCCCTTTGG - Intergenic
1017924147 6:158896296-158896318 CCCTAAGTTCTTTCTCTGTTGGG + Intronic
1019737160 7:2656282-2656304 TCCTCAGCCCTGCCTCTGGGGGG + Intronic
1021036933 7:15810662-15810684 TCCTCAGCTCCACCTCAGTCTGG + Intergenic
1022099716 7:27161814-27161836 GCCTCAGCCCTGCCTCTGTTAGG + Intergenic
1022200075 7:28108172-28108194 TCCTCAGCCCTTGCTCTGCCAGG + Intronic
1022239367 7:28494911-28494933 TCATCAGATGGTCCTCTGTTGGG - Exonic
1022809500 7:33855134-33855156 TCCTCCGCTCTTCCACTCTGGGG - Intergenic
1022892314 7:34714144-34714166 TCCTCAGTTCCTCCTCACTTGGG + Intronic
1022944728 7:35270927-35270949 CTCTCATCTCTACCTCTGTTGGG + Intergenic
1026364929 7:69638551-69638573 TCCTCTTTTTTTCCTCTGTTTGG + Intronic
1029129792 7:98321422-98321444 TGCTCAGCCCTGCCTCTGCTGGG + Intronic
1030147299 7:106369686-106369708 GCCCCAGCTCTTCCCCTGCTTGG + Intergenic
1031129640 7:117816873-117816895 TATTCAGCTCTTCCTTTTTTAGG - Intronic
1031848978 7:126840883-126840905 TTTTCAGATCTTCCTCTGATAGG - Intronic
1031875287 7:127132727-127132749 ACATCAGCTCTTCCCCTGCTTGG - Intronic
1032768802 7:135026900-135026922 TCCTCAGTTACTCCTCTTTTTGG + Intronic
1032995620 7:137442940-137442962 ACCTCACCTCATCCTCTGTAAGG - Intronic
1033039588 7:137905800-137905822 TCCTCTTCTCCTCCTCTGTCAGG + Exonic
1033610819 7:142961839-142961861 CCCTCGGCTCTTCCTCACTTTGG + Exonic
1033767640 7:144511384-144511406 TCCTCAGCTCTTCTTGCGGTGGG + Intronic
1036595522 8:10208583-10208605 TCCTTACCTCTTCTTCTGTTGGG + Intronic
1037386377 8:18347010-18347032 TCCTCAGCAATTCCTGTCTTTGG - Intergenic
1038602705 8:28962899-28962921 TCCTAAGCTCCTCTACTGTTGGG + Intronic
1039642867 8:39242591-39242613 TCCTGTGCTCTTCCTGTGATAGG - Intronic
1040604220 8:48913850-48913872 TGCTCAGCTCTTCATCTCTCTGG + Intergenic
1040706689 8:50136877-50136899 TCCTGACCTCTTCCTCATTTTGG - Intronic
1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG + Intronic
1042568699 8:70139063-70139085 TGCTCTGCTCTTTCTCTGGTAGG - Intronic
1042867633 8:73369594-73369616 GCCTCAGCTCTTCATCTGTATGG + Intergenic
1044340877 8:91044966-91044988 TCCTCATCTGTTCCTATATTTGG + Intergenic
1045101726 8:98851243-98851265 TCTTAAGCTCCTACTCTGTTTGG - Intronic
1045372791 8:101541747-101541769 TCCTCAGCATTTCCCCTGCTGGG - Intronic
1045508282 8:102794232-102794254 GCCTCACCTCTTCCTCTGGGAGG - Intergenic
1046970429 8:120216877-120216899 TACTTAGCTCTCTCTCTGTTTGG - Intronic
1047433609 8:124815735-124815757 TCAGTAGCTCCTCCTCTGTTGGG + Intergenic
1050418838 9:5441082-5441104 TTCTCTGTTCTTTCTCTGTTTGG + Intergenic
1051172268 9:14330695-14330717 TCCTCAGGTCTACCTCCATTTGG - Intronic
1053576522 9:39360569-39360591 TCCTAAGCTCCTGCTCTGCTGGG - Exonic
1053599418 9:39595197-39595219 TCCAAAGCTCTTCCTCTATCAGG - Intergenic
1053841032 9:42188494-42188516 TCCTAAGCTCCTGCTCTGCTGGG - Exonic
1053857123 9:42349382-42349404 TCCAAAGCTCTTCCTCTATCAGG - Intergenic
1054568170 9:66781352-66781374 TCCAAAGCTCTTCCTCTATCAGG + Intergenic
1054588263 9:66987672-66987694 TCCTAAGCTCCTGCTCTGCTGGG + Intergenic
1054734951 9:68741736-68741758 GCCTCACCTCTTCCTCTCTTTGG + Intronic
1055655252 9:78444562-78444584 ACCTCTCCTCTTGCTCTGTTTGG + Intergenic
1055986294 9:82058866-82058888 TCCTAAGCTCCTGCTCTGCTGGG + Intergenic
1056121343 9:83492176-83492198 TCATCAAATCATCCTCTGTTAGG - Intronic
1056585049 9:87922267-87922289 TCCTAAGCTCCTGCTCTGCTGGG - Intergenic
1056611830 9:88130673-88130695 TCCTAAGCTCCTGCTCTGCTGGG + Intergenic
1056775388 9:89508610-89508632 TCCTCCCTTCTTCCTCGGTTTGG + Intergenic
1057160878 9:92887317-92887339 TCCTAAGCTCCTGCTCTGCTGGG - Intergenic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1058299482 9:103353408-103353430 TTCTAAGTTCTTCCTCAGTTTGG + Intergenic
1059581150 9:115549990-115550012 TTCTCAGTTTTTGCTCTGTTTGG - Intergenic
1060062844 9:120476328-120476350 TCCTCAGCTTCTGCACTGTTTGG + Intronic
1061297034 9:129682380-129682402 TCCTCAGCCCCTCCTCTCTTAGG - Intronic
1061661652 9:132134184-132134206 ACCTGAGCTCTTCCTCTGAAAGG + Intergenic
1061727961 9:132591420-132591442 TCCCCAGCTCTGGCTCTGGTGGG + Intergenic
1062371379 9:136240901-136240923 CCCTCAGCCCGTCCTCTGTCAGG + Intronic
1062638651 9:137505542-137505564 GCCTCCTCTCTGCCTCTGTTGGG - Intronic
1185505190 X:627940-627962 TCCCCATCTCTGCCTCTGCTGGG - Intronic
1185988801 X:4869411-4869433 TGTTCAGCTCTTCCTTTCTTTGG - Intergenic
1187228071 X:17393544-17393566 GCTTCAGCTCTTCCTCTGTGAGG + Intronic
1187361724 X:18634255-18634277 TCCTCAGGACTTCCTTTGGTTGG + Intronic
1188244030 X:27820099-27820121 TCCTCACCTTTACTTCTGTTAGG - Intronic
1188261515 X:28030421-28030443 TCCCCAGCCCATCCTCTGTCTGG - Intergenic
1189995884 X:46637295-46637317 GCCTCAGCTCTTCCTCTTATAGG + Intronic
1193108309 X:77703424-77703446 GCATCAGCTCTTTCTCTGTGAGG + Intronic
1193442214 X:81556624-81556646 TCCACAGCTACTCTTCTGTTGGG - Intergenic
1194994057 X:100574021-100574043 TTCTCTCCTCCTCCTCTGTTAGG + Intergenic
1195090818 X:101457477-101457499 TGCCCACCTCTGCCTCTGTTGGG - Intronic
1196970479 X:121102610-121102632 TGCTCAGCTTTTCCTCTGCTTGG - Intergenic
1198047253 X:132915114-132915136 TCCTCAGCTCCTCCTTGGTTTGG + Intronic
1199202137 X:145104234-145104256 TCATCAGTTTTTTCTCTGTTGGG - Intergenic
1199521797 X:148744257-148744279 TCCTCAGCCCTTCCACTCATTGG - Intronic
1199718588 X:150525413-150525435 TCCACCTCTCTTCCTCTGTAGGG + Intergenic