ID: 1057721064

View in Genome Browser
Species Human (GRCh38)
Location 9:97532291-97532313
Sequence TCATGGGTCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057721064_1057721071 2 Left 1057721064 9:97532291-97532313 CCCTCTGCCCTCTGGACCCATGA 0: 1
1: 0
2: 0
3: 35
4: 335
Right 1057721071 9:97532316-97532338 ACCTCTCCCAACCCCTCCTCTGG No data
1057721064_1057721074 7 Left 1057721064 9:97532291-97532313 CCCTCTGCCCTCTGGACCCATGA 0: 1
1: 0
2: 0
3: 35
4: 335
Right 1057721074 9:97532321-97532343 TCCCAACCCCTCCTCTGGCTGGG No data
1057721064_1057721076 8 Left 1057721064 9:97532291-97532313 CCCTCTGCCCTCTGGACCCATGA 0: 1
1: 0
2: 0
3: 35
4: 335
Right 1057721076 9:97532322-97532344 CCCAACCCCTCCTCTGGCTGGGG No data
1057721064_1057721073 6 Left 1057721064 9:97532291-97532313 CCCTCTGCCCTCTGGACCCATGA 0: 1
1: 0
2: 0
3: 35
4: 335
Right 1057721073 9:97532320-97532342 CTCCCAACCCCTCCTCTGGCTGG No data
1057721064_1057721082 24 Left 1057721064 9:97532291-97532313 CCCTCTGCCCTCTGGACCCATGA 0: 1
1: 0
2: 0
3: 35
4: 335
Right 1057721082 9:97532338-97532360 GCTGGGGAACCTCCTCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057721064 Original CRISPR TCATGGGTCCAGAGGGCAGA GGG (reversed) Intronic
900387374 1:2416750-2416772 ACAGGGGTGCAGAGTGCAGAGGG + Intergenic
900689202 1:3969685-3969707 TCTTGCAGCCAGAGGGCAGATGG - Intergenic
901095510 1:6676145-6676167 TCCTGGCTCCAGTGGGCAGTTGG - Intronic
901270064 1:7945395-7945417 GTGTGGGTCCAGAGAGCAGATGG - Intergenic
901454513 1:9355415-9355437 TCAGGGTTCCACAGGGCGGAAGG - Intronic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
904325509 1:29725170-29725192 TCGTGGATCCAGTGGGCAGTGGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905971371 1:42144883-42144905 TGATGTTTGCAGAGGGCAGAGGG + Intergenic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
907313129 1:53551369-53551391 GCATGGGTGCAGGGTGCAGATGG - Intronic
909167438 1:72247053-72247075 TCAAGGCTGCATAGGGCAGAAGG + Intronic
909204263 1:72733545-72733567 ACATGGATCCAAAAGGCAGAGGG - Intergenic
911165566 1:94721434-94721456 TAATGCAACCAGAGGGCAGAAGG + Intergenic
911553619 1:99315481-99315503 TAATGTGTCCAGATGGCAGTAGG + Intergenic
912415160 1:109503293-109503315 TCCTGGATCCCTAGGGCAGAGGG - Intergenic
912730151 1:112095045-112095067 TCATGGGGCCAGATAGAAGAGGG + Intergenic
913610060 1:120502149-120502171 TCATGGGGCCAGAGCTCAGCTGG + Intergenic
914203744 1:145508990-145509012 TCATGGGGCCAGAGCTCAGCAGG - Intergenic
914482867 1:148082144-148082166 TCATGGGGCCAGAGCTCAGCAGG - Intergenic
914581128 1:149020093-149020115 TCATGGGGCCAGAGCTCAGCTGG - Intronic
916144824 1:161728853-161728875 TGATGGCTCCAGTAGGCAGATGG - Intergenic
916242873 1:162657542-162657564 TAATGGGTACTGAGAGCAGAAGG + Intronic
916880765 1:169017811-169017833 ACCTGGGTCCAGAATGCAGATGG + Intergenic
917802347 1:178581997-178582019 TCAAGGGGCCAGAGAGCAGATGG - Intergenic
918966732 1:191360317-191360339 TCATGGTTATAGAGGCCAGAAGG + Intergenic
920559665 1:206930286-206930308 TCATGGGTGCAGGGAGCAGGCGG + Exonic
920760514 1:208779747-208779769 TCTTGAATCCAGGGGGCAGAGGG - Intergenic
921501615 1:215911383-215911405 TCATGGGTTTAGAGAGTAGAAGG - Intronic
921867348 1:220099613-220099635 TCATAGGTGAAGAGGACAGATGG + Intronic
922109225 1:222541261-222541283 TACTGGGTGCAAAGGGCAGAAGG + Intronic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
1062903472 10:1163189-1163211 CCGTGGGTCCAGAGGGCAAGAGG - Intergenic
1063592186 10:7406115-7406137 TCATGGGTGCAGTGGTCAGAAGG - Intronic
1063756517 10:9016710-9016732 TCATGAGTCCAGTTGGCAAAAGG + Intergenic
1063813946 10:9749319-9749341 TCCTGGTTCAAGAGAGCAGAGGG + Intergenic
1064230113 10:13522348-13522370 GCCTGGCTCCACAGGGCAGAGGG + Intronic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1067851225 10:49755951-49755973 TGATGGGTCCTCAGGCCAGAAGG + Intronic
1068043400 10:51856095-51856117 TTATGGGTCAATGGGGCAGAAGG - Intronic
1071484005 10:86085875-86085897 CCATGGGTCCCGATGGCAGTGGG - Intronic
1072295053 10:94000857-94000879 TCATAGGTCCTGAAAGCAGAAGG - Intronic
1072905764 10:99451771-99451793 TCAAGGGTGCTGTGGGCAGAAGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073153926 10:101331585-101331607 TCATTGTTCCACAGGTCAGAAGG - Intergenic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1074656252 10:115591377-115591399 TCTAGTCTCCAGAGGGCAGAAGG - Intronic
1074716665 10:116226211-116226233 TCAAGGATCCAGTTGGCAGAGGG - Intronic
1075086950 10:119419962-119419984 TTATGGGTCCTGAGGGGATAAGG + Intronic
1076704414 10:132293467-132293489 TCATGGGGACACAGGGCAGGCGG + Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1076775740 10:132697126-132697148 TGCTGGGTCCAGTGGGCAGGTGG - Intronic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1079203748 11:18396138-18396160 GCATCGGGCCAGAAGGCAGAAGG - Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083182505 11:60996319-60996341 TCTGGGGTCCAGAGTGCAGGGGG - Intronic
1083332412 11:61905053-61905075 TCTTTGGTGCAAAGGGCAGAAGG - Intronic
1084562783 11:69913788-69913810 TCATCGGTTCACTGGGCAGATGG + Intergenic
1085874665 11:80391718-80391740 TCATGGGTCAAGATTCCAGATGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1087337869 11:96866861-96866883 TCATGGATCCAGAAGGCAATAGG + Intergenic
1088370789 11:109086257-109086279 TTATAGGGCCAGAGGCCAGAGGG - Intergenic
1089626499 11:119754507-119754529 TCAGGGATCCAGAAGCCAGAAGG + Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1092441985 12:8512513-8512535 TGATGAGTCCAGAGGACAGCTGG - Intronic
1094053126 12:26242371-26242393 TAATGTTTGCAGAGGGCAGAGGG - Intronic
1095815305 12:46415497-46415519 TCATGGAAACAGAGAGCAGAAGG - Intergenic
1096436001 12:51591413-51591435 TCAAGGGTCCCGAGGCGAGAAGG - Intronic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1097043448 12:56170198-56170220 TCATGGGCCCAGAGGAGAGCGGG - Exonic
1097753587 12:63384824-63384846 TGGGGGTTCCAGAGGGCAGAAGG - Intergenic
1098323024 12:69268581-69268603 TTAAGAGTCAAGAGGGCAGAAGG - Intronic
1100759644 12:97792923-97792945 TCATGGGTCATGAGTCCAGATGG + Intergenic
1102124295 12:110468159-110468181 TCATGGGCCCCGCGGGCAGCGGG - Intronic
1102985943 12:117278376-117278398 TCATGGGCCCACAGGACAGAGGG + Intronic
1104174088 12:126312249-126312271 TAATGGCTACAGAGGGCAAAGGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105434650 13:20365996-20366018 TCATGTCTCCACAGAGCAGAGGG - Intergenic
1106638545 13:31558170-31558192 TGAAGGGTCCATAGAGCAGAGGG + Intergenic
1107510992 13:41084769-41084791 TCATAGGTCCAGATGTCATAAGG - Intergenic
1108486888 13:50935773-50935795 GCATGGGTCCAGATGGTAAAGGG + Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113756214 13:112812806-112812828 TCGGGGGTTCAGAGAGCAGATGG + Intronic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1115074881 14:29376324-29376346 TCATGGGTACTGAGGGAGGAAGG - Intergenic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1116099746 14:40418239-40418261 TCTTGGGTCCAGAGAACAAAAGG - Intergenic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117870311 14:60193873-60193895 TCATGGATCCACAGGGCCAAAGG + Intergenic
1120510695 14:85410499-85410521 TGATGGGTTCAGAGTGCATATGG + Intergenic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1121106042 14:91280298-91280320 TCCTGGGTCCACAGGGCACCTGG + Intronic
1121619838 14:95338456-95338478 TCATGGAAACACAGGGCAGAGGG + Intergenic
1121694735 14:95903755-95903777 TCCTGGGTACTGGGGGCAGATGG + Intergenic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122888674 14:104722908-104722930 ACATGGGTGCAGGGGGCAGGAGG + Intergenic
1123849143 15:24336077-24336099 TCATGGATACAGAGAGTAGAAGG - Intergenic
1124334578 15:28847527-28847549 TCATGTATCCTCAGGGCAGAAGG + Intergenic
1125278964 15:38024573-38024595 TTATGGATCCTGAGGCCAGAGGG + Intergenic
1125993164 15:44130132-44130154 TGATGGGTTTAGAGGGGAGAGGG - Intronic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1127672756 15:61211666-61211688 TGATGGCCACAGAGGGCAGAGGG + Intronic
1127677162 15:61251109-61251131 TCATGGTTTCAGAGGGAAAAAGG + Intergenic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1128998137 15:72311916-72311938 GCTTGGGTAGAGAGGGCAGATGG - Intronic
1129946749 15:79545142-79545164 TCATGGGAACAGAGAGGAGAGGG + Intergenic
1130231089 15:82097514-82097536 TCAGGGGGCCTGAGGCCAGAAGG - Intergenic
1130905703 15:88239631-88239653 TCAGGGGTGCAGAGAGAAGAGGG + Intronic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1132154171 15:99484088-99484110 TCATGGGGCCGGGGGGCAGTGGG - Intergenic
1132343682 15:101093763-101093785 TCATGGCTCCTGAGGGTTGATGG - Intergenic
1132658816 16:1052641-1052663 TGATGGGTCCAGCAGGCAGCAGG + Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133674415 16:8057142-8057164 TCATGGGTCCAGGAGGCCCACGG + Intergenic
1135195258 16:20388943-20388965 TCAAGGTTCCAGAGCCCAGAAGG - Intronic
1135933913 16:26762814-26762836 ACATGAGCCCAGAGGACAGAGGG + Intergenic
1136402657 16:30026961-30026983 TGAGGGATCCAGAGGGTAGAGGG + Intronic
1137841522 16:51645093-51645115 TCATGCTTCCACAGTGCAGATGG - Intergenic
1139666386 16:68459775-68459797 TTCTGGGTCCCAAGGGCAGAGGG - Intergenic
1140449780 16:75061333-75061355 TCATGGACACAGAGGGTAGAAGG - Intronic
1142380633 16:89730014-89730036 ACAAAGGTCCAGAGGGCAGGTGG + Intronic
1142715632 17:1745494-1745516 TCTGGAGTCCAGAGGCCAGAAGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143165224 17:4894159-4894181 TCAGGGGTCTACAGGACAGAGGG - Exonic
1143298374 17:5888669-5888691 TCTTGGTTCTAGAAGGCAGATGG - Intronic
1144340305 17:14304252-14304274 TCCCGGGTCCAGGGGGCACAGGG + Intronic
1144901805 17:18600767-18600789 ACATGCGTCTAGAGAGCAGATGG + Intergenic
1145852382 17:28113270-28113292 GTATGGATCCAGAGGGCACAGGG - Intronic
1146548114 17:33756582-33756604 TCCTGGGTCCAGATGCTAGAAGG - Intronic
1146740951 17:35283075-35283097 ACATTGGTCCAGCAGGCAGAGGG + Intergenic
1146826971 17:36031520-36031542 GCATGAGTGCAGGGGGCAGAGGG - Intergenic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148126596 17:45240658-45240680 TCATAGGCCCACAGGGCACACGG + Intronic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1148475624 17:47926878-47926900 TCCTGGGGCTAGAGGGCTGAGGG + Intronic
1148862409 17:50611485-50611507 TCATGGGGCCATAGCGCTGAGGG - Intronic
1148891937 17:50814224-50814246 TGCTGGAGCCAGAGGGCAGAGGG + Intergenic
1149663249 17:58347551-58347573 TGATGAGTCCAGAGGACAGCTGG - Exonic
1150287862 17:63964025-63964047 TCAAGGGTCTTCAGGGCAGAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150712337 17:67542598-67542620 TCATAAGTCCACAGGGCAGTGGG + Intronic
1150950800 17:69801041-69801063 TCCTGGGCCCAGAGAGCACAGGG - Intergenic
1151393536 17:73803960-73803982 CCATGGCTCCAGAGGGCCAATGG - Intergenic
1151395984 17:73823384-73823406 TCCTGCATCAAGAGGGCAGATGG - Intergenic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152691354 17:81719566-81719588 CCCGGGGTCCAGTGGGCAGAGGG - Intronic
1152895497 17:82908671-82908693 GCATGGCTGCAGAGTGCAGACGG + Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157928765 18:51795834-51795856 ACATGGGTCCACTGGGCACAGGG + Intergenic
1158446188 18:57523677-57523699 TGGTGGGTCCTGAAGGCAGAAGG + Intergenic
1160137584 18:76285789-76285811 TCAGGGGTCCAGAGAGTAGAAGG + Intergenic
1160214402 18:76915139-76915161 TCATCGGTCCAGAGGAGAGAGGG + Intronic
1160907473 19:1458232-1458254 TCATGGGGACAGAGGGCCCAGGG - Intronic
1161008257 19:1947384-1947406 TCCTGGGGACAGAGGTCAGATGG - Intronic
1161384575 19:3984106-3984128 GCCTGGGTACAGAGGGCACAGGG + Intronic
1161854282 19:6754516-6754538 TCATGGTTCCCCAGGGAAGAAGG - Intronic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1163338081 19:16686660-16686682 TCTTGGGTACAGAGACCAGAGGG + Intronic
1164773790 19:30834630-30834652 TCACAGGTCCAGAGGACAGGAGG - Intergenic
1164995829 19:32720048-32720070 TCCTGGCGCCCGAGGGCAGATGG - Intronic
1166211480 19:41309325-41309347 TGATGGATCCAGAGGGCTGAGGG - Intronic
1166546055 19:43635483-43635505 TCCTGGGTCCTGAGGGAGGAAGG - Intronic
1166871179 19:45872179-45872201 CCAGGGGTCCTGAGGGCAGTGGG - Exonic
1168715984 19:58527689-58527711 CCATGGGTCCAGCAGGAAGACGG - Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925415844 2:3669681-3669703 TTCTGGGTCCAGTGGGCAGGTGG + Intronic
925457067 2:4024788-4024810 GCATGGGGGCAGAGGGCAGTGGG - Intergenic
926531310 2:14049672-14049694 ACATGGGCCTTGAGGGCAGAGGG - Intergenic
927717257 2:25360777-25360799 TCAAGGGTCCCGAGGGCACCTGG + Intergenic
927752885 2:25685763-25685785 TCATGAGGCCAGAGGCTAGATGG + Intergenic
927853078 2:26511987-26512009 TGCTGGGGCCAGAGGGCAGTGGG - Intronic
928212958 2:29337377-29337399 TCATGGTCCCAGAGGGCTGATGG - Intronic
928215800 2:29360417-29360439 TCCTGTCTCCAGAGGTCAGAAGG - Intronic
928242500 2:29598554-29598576 CCATGGGTCTAGAGAGCAAAGGG + Intronic
930484650 2:51997154-51997176 TCATGAGTCCAGATGGCATGGGG + Intergenic
930771963 2:55138046-55138068 TCATGGGTCTAGAGGCCTCAGGG - Intergenic
930956128 2:57205009-57205031 TCAATGCTCCAGAGGGTAGATGG + Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931852400 2:66265008-66265030 TCATAGTTCTAGAGGCCAGAAGG - Intergenic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
932895477 2:75635485-75635507 TCCTGGGTAAAGAGGGCTGAGGG - Intergenic
933209347 2:79549021-79549043 TTATGTGTCCACAGGGCATACGG + Intronic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
935291494 2:101614361-101614383 ACATGGGTCCAGAGTCCAGGAGG - Intergenic
935332649 2:101988528-101988550 TCCTGGGCCCACGGGGCAGAAGG + Intergenic
935800214 2:106688273-106688295 TCTTGGTTCCAGATAGCAGATGG + Intergenic
936121822 2:109752904-109752926 TCATGGAGACAGAGAGCAGAAGG - Intergenic
936222873 2:110618568-110618590 TCATGGAGACAGAGAGCAGAAGG + Intergenic
936259593 2:110947621-110947643 TAATGGGTCCTGGAGGCAGAGGG - Intronic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
938408667 2:131046438-131046460 ACACAGGTCCAGAGGGCGGATGG - Exonic
940751344 2:157629363-157629385 TTATAGGTCCAGAAGGCAGTCGG - Intergenic
944478932 2:200135317-200135339 TCATGGGTCCTGGGGTCAGCTGG + Intergenic
946474224 2:219992213-219992235 GCAGGGCTCCAGAGTGCAGAGGG + Intergenic
947739769 2:232479792-232479814 TCACGGGTCCCCAGGGCAGGCGG - Intergenic
948504060 2:238415916-238415938 TCATGGGTGGGGAGGGTAGAGGG + Intergenic
948839265 2:240641150-240641172 TCATGGGGCGAGGGGGCAGCTGG + Intergenic
1168924484 20:1567904-1567926 TCTTGGAGCCACAGGGCAGAAGG + Intronic
1169554354 20:6733952-6733974 TCATGGGTCTGAAGGGCAGCTGG + Intergenic
1169835484 20:9873344-9873366 TCATGAGTCCAGAGTCCAGGTGG - Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1172514541 20:35523738-35523760 TCAAGGGTCCAGGGGACAGGAGG + Intronic
1172767125 20:37356770-37356792 TCCAGGTTCAAGAGGGCAGAGGG - Intronic
1173126223 20:40338554-40338576 TCCTGGGTCCTGAGGACATAGGG - Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1175469870 20:59219899-59219921 TGATGGGTTCAGTGGGCAGGTGG + Intronic
1177919221 21:27129582-27129604 TCCAGCGTACAGAGGGCAGAGGG + Intergenic
1178389598 21:32187461-32187483 TCTTGGGTCCAGAGGGATGGGGG + Intergenic
1178491261 21:33053558-33053580 TGATGGGTCCACAGAGCAGTAGG + Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179457829 21:41511662-41511684 TCATGCTTCCCGAAGGCAGAGGG - Intronic
1179901839 21:44398281-44398303 GCTTGAATCCAGAGGGCAGAGGG - Intronic
1180590348 22:16931973-16931995 TTATGGTTCCAGAGGGTAGAAGG + Intergenic
1181404432 22:22672738-22672760 ACATTGGTCCTGTGGGCAGAGGG + Intergenic
1181807448 22:25383639-25383661 TCCTGGAGCCACAGGGCAGAGGG + Intronic
1181938693 22:26458009-26458031 TCATGGGGTGGGAGGGCAGAAGG - Intronic
1182455544 22:30448067-30448089 TCATGGGCAGAGAGGGCAGGAGG - Intronic
1182700066 22:32229604-32229626 TCATGGCTATAGAGAGCAGAAGG + Intronic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1184416932 22:44357654-44357676 TCGGGGGTCCAGAGGGCACCTGG + Intergenic
1184540841 22:45123241-45123263 TTATCTGTCCAGAGGGGAGAAGG + Intergenic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185167159 22:49268545-49268567 GCATGGCTCCAGATGCCAGATGG - Intergenic
1185414692 22:50703685-50703707 TCCTGGGTCCAGAGGTAAGAAGG - Intergenic
1203290440 22_KI270735v1_random:32110-32132 TCATAGATCCAGAGAGAAGAGGG + Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
951630649 3:24716512-24716534 TCATGGGGCCAGTGGGGAGGGGG + Intergenic
951663345 3:25095051-25095073 TCACTGGACCAGAGGCCAGAAGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951900170 3:27649515-27649537 TCATGAGTCCAAAGAGCAGTGGG - Intergenic
952247060 3:31606359-31606381 TCATAGGTCCAGAGGCCTAAAGG + Intronic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
953617284 3:44502725-44502747 TCAAGGGTACAGAGGGCACAGGG + Intronic
954700594 3:52448870-52448892 TGATGGCTGCAGAGGGCAAAAGG - Intergenic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
955071903 3:55578686-55578708 TCATGAGTCCACAGGTCAGTTGG + Intronic
955249397 3:57263437-57263459 TCATGGAGCCAGAGAACAGAAGG - Intronic
955693721 3:61615086-61615108 TCAAGTGTCCAGAGGGGACAGGG - Intronic
956251435 3:67238356-67238378 TCACGAGTACAGAGGGCAGCTGG + Intergenic
956475179 3:69611825-69611847 TCATGAATCCAGATGGCAGAAGG + Intergenic
956711247 3:72040579-72040601 TCCTGGGTCCAGGGAGCATAGGG - Intergenic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
958557672 3:95701424-95701446 TCATGGACACAGAGAGCAGAGGG + Intergenic
963280015 3:143374963-143374985 TCATGGATCTAGAGAGTAGAAGG - Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
969146348 4:5127351-5127373 TCTTGAGTGCAGAGGGCAGAGGG + Intronic
969386060 4:6849190-6849212 GCAGGGGTCCAGGAGGCAGATGG + Intronic
970161195 4:13191044-13191066 TCAGGGGTCCACAGGTCAGCTGG + Intergenic
973174131 4:47183496-47183518 TCACAGGTCCAGAAGACAGAAGG - Intronic
974337144 4:60563843-60563865 TCATGGACACAGAGAGCAGAAGG - Intergenic
974781048 4:66553190-66553212 TCATGGACCTAGAGGGTAGAAGG + Intergenic
975984004 4:80186591-80186613 TCACGCCTCCAGAGGGCTGAAGG + Intronic
980135577 4:128855646-128855668 TCAAGGTACCAGAGGGCAGCTGG + Exonic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980651772 4:135726172-135726194 TCTTGGGTCCAGGGACCAGAAGG - Intergenic
982274265 4:153623171-153623193 TCAGGAGTGCAGAGGACAGATGG + Intronic
982308705 4:153961176-153961198 TCAGGGGTCCAGACAGCATAGGG + Intergenic
983169878 4:164523301-164523323 TCATGGGACCAGAGCTCAGTTGG - Intergenic
986393432 5:7305538-7305560 TCATGTATCCTCAGGGCAGAAGG + Intergenic
988483445 5:31648560-31648582 GCATGGGTCCAGGGGTGAGATGG - Intronic
990593557 5:57291099-57291121 TCATGGAGCTAGAGAGCAGAAGG + Intergenic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
993225912 5:85167146-85167168 CCATGGCTTCAGAGGGCACAAGG + Intergenic
993326105 5:86538567-86538589 TCATGGTTCCAGAAGCAAGAAGG + Intergenic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
995487484 5:112653757-112653779 TCAGCAGTCCACAGGGCAGATGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997676540 5:135717284-135717306 TCATGGGTTGACAGGGCAGAGGG - Intergenic
997914096 5:137906900-137906922 TTATGAGTCCAGAGGGCACCAGG + Intronic
999194774 5:149774480-149774502 TCGTGGGACCAGAAGCCAGAAGG - Intronic
1000010528 5:157227220-157227242 TCAGAGGTCCAGAGAGTAGAAGG + Intronic
1000820615 5:165978429-165978451 TCATGGGTACTGGGGTCAGATGG + Intergenic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1002306530 5:178286912-178286934 TCACAGGTCCAGAGGGGAGAGGG - Intronic
1004527639 6:16424253-16424275 TCAAGGGACGAGAGGGAAGAAGG + Intronic
1004959763 6:20773901-20773923 TGATGGGGGCAGAGGGCAGAGGG - Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1005834983 6:29702248-29702270 GCCTTGGTCCAGAGAGCAGAAGG - Intergenic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1006466038 6:34195612-34195634 TCATGGGTCCCCACGGTAGAGGG - Intergenic
1007232578 6:40358737-40358759 CCATGGGGCCAAAGTGCAGAGGG - Intergenic
1007237514 6:40401395-40401417 CCAAGGGTCCAGCTGGCAGAAGG - Intronic
1007322453 6:41037506-41037528 TCATGGGTCCTGAGGTTGGAAGG - Intronic
1007766677 6:44164754-44164776 TCGTGGGGCCAGATGGCAGGTGG + Intronic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1013723578 6:113063372-113063394 TCATGGAGAAAGAGGGCAGAAGG - Intergenic
1016708182 6:147138181-147138203 TCACAGTTCCAGAGGGTAGAAGG - Intergenic
1017058333 6:150457425-150457447 TACGGGCTCCAGAGGGCAGAGGG + Intergenic
1017189530 6:151637249-151637271 ACATGAATCCAGATGGCAGAAGG - Intergenic
1017275750 6:152565971-152565993 TGATGGGAGCAGAGGGCACAGGG + Intronic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019333834 7:473372-473394 CCCTGGGTCCAGGAGGCAGACGG + Intergenic
1019546832 7:1581890-1581912 TCAGGGCTTCAGCGGGCAGAGGG - Intergenic
1019849639 7:3541557-3541579 TCATGGGTACAGTGGTAAGAAGG - Intronic
1022509390 7:30925638-30925660 TCAGGGGTCTTGAAGGCAGAAGG - Intergenic
1022531208 7:31068040-31068062 TCTGGGCTTCAGAGGGCAGATGG + Intronic
1023203144 7:37720252-37720274 TCCTGGGTTCACAGGGCACAGGG + Intronic
1026741873 7:72983963-72983985 CCATGGGTCCCCAGGGCAGCAGG - Intergenic
1026801717 7:73404388-73404410 CCATGGGTCCCCAGGGCAGCAGG - Intergenic
1027101862 7:75381114-75381136 CCATGGGTCCCCAGGGCAGCAGG + Intergenic
1027473060 7:78596393-78596415 TCTTGGGGCCAGAGGACTGATGG - Intronic
1029503685 7:100949606-100949628 GCATGGGCCCAGCGGGCAGGGGG - Exonic
1029642393 7:101829377-101829399 TCATGGGAACAGATGGCGGACGG + Intronic
1029712171 7:102305757-102305779 TCGTGGGTGCATTGGGCAGAGGG + Intronic
1031345366 7:120659103-120659125 TCAGGGGTCAAGAGTGCAAAAGG + Intronic
1033315329 7:140292426-140292448 TCATGGGGCCAGGGGTCAGGAGG - Intergenic
1033815211 7:145062956-145062978 TCTTGGGTCAAGAAGGGAGATGG - Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1036406872 8:8462874-8462896 TCTTAAGTCCAGAGGGCAGAAGG + Intergenic
1037766030 8:21772833-21772855 GCATGAGTCCAGGGAGCAGAAGG + Intronic
1039520486 8:38166799-38166821 TCATGGGTTGGGAGGGCAGGTGG - Intronic
1039997828 8:42549599-42549621 TAATGGGTCCAGAGTTCAGTTGG + Intronic
1041948948 8:63478324-63478346 TCATGGTTTCAGAGAGCAGAAGG + Intergenic
1042694460 8:71541033-71541055 TCATGGCTCCAGAAGCCACAAGG + Intronic
1046002942 8:108443544-108443566 TCATTGGCCAAGAGAGCAGAGGG - Intergenic
1046040188 8:108894244-108894266 TCATGAGTCAAGAGTCCAGATGG - Intergenic
1047224139 8:122942578-122942600 TCGGGGGTTCAGAGGCCAGAGGG - Intronic
1047327273 8:123851872-123851894 TCATGGGTCCAGAGATCAAGGGG - Intergenic
1047435699 8:124834039-124834061 TCATGGGTGCTGAGGGTAAAGGG - Intergenic
1047627393 8:126670035-126670057 TCATTGATTCAGAAGGCAGAGGG - Intergenic
1047683276 8:127277024-127277046 GCATTGGACTAGAGGGCAGAGGG - Intergenic
1048541465 8:135345753-135345775 TCTTGGGACCAGAAGGCAGGAGG - Intergenic
1049330771 8:142049313-142049335 TCATGGGGCCACAGGGAGGATGG - Intergenic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1052853782 9:33394422-33394444 TAATGAATCCAGAGGGCAGTGGG - Intronic
1056876618 9:90339329-90339351 TGATGGGGCCAGAGGGCTGGAGG + Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057885935 9:98829649-98829671 TCATGGAGACAGAGAGCAGAAGG - Intronic
1058423048 9:104851489-104851511 GCATTGGTCCAGAGAGGAGAGGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061507654 9:131040650-131040672 GCAAAGGTCCAGAGGACAGAGGG - Intronic
1061599148 9:131655199-131655221 TCTTTGGTCCAGAGCGCAGTGGG - Intronic
1062351605 9:136142368-136142390 TCTGGGGTTCAAAGGGCAGAGGG + Intergenic
1062566533 9:137166218-137166240 TCTGGGCTCCAAAGGGCAGAAGG - Intronic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1188923979 X:36016334-36016356 TCATGGAGACAGAGAGCAGAAGG - Intergenic
1189657409 X:43259971-43259993 TCATGGATACAGAGAGTAGAAGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190155965 X:47992682-47992704 TCACAGGTCCAGACGGAAGAGGG - Intronic
1191587025 X:62838904-62838926 TCATGGGTACAGAGCGAGGAGGG - Intergenic
1193579173 X:83241813-83241835 TCATGGACACAGAGGGTAGAAGG + Intergenic
1193680422 X:84512357-84512379 TCATGGACACAGAGAGCAGAAGG + Intergenic
1194521748 X:94927696-94927718 TCATGGATGTAGAGAGCAGAAGG - Intergenic
1195250779 X:103044421-103044443 TCATGGAGCTAGAGAGCAGAAGG - Intergenic
1195859994 X:109373424-109373446 TCCTGGGTCCTGATAGCAGAAGG + Intronic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196768398 X:119270408-119270430 TCCTGGGTCCAGTGTGCAGAAGG - Intergenic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1201709554 Y:16975365-16975387 TCATGGGAGCAGTAGGCAGAAGG + Intergenic
1201782795 Y:17741941-17741963 TCATGGGGCCAGAAGGAAAAAGG - Intergenic
1201818758 Y:18164046-18164068 TCATGGGGCCAGAAGGAAAAAGG + Intergenic