ID: 1057723639

View in Genome Browser
Species Human (GRCh38)
Location 9:97553448-97553470
Sequence TACAAGGCTCCCTGCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057723639_1057723644 27 Left 1057723639 9:97553448-97553470 CCACATCTGCAGGGAGCCTTGTA 0: 1
1: 0
2: 3
3: 11
4: 150
Right 1057723644 9:97553498-97553520 CTATTTCTAACAAGAACTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057723639 Original CRISPR TACAAGGCTCCCTGCAGATG TGG (reversed) Intronic
900810678 1:4799382-4799404 TCCAAGCCTTCCTGCAGAAGAGG - Intergenic
901971462 1:12912211-12912233 TACATGGATCCATGCAAATGAGG - Intronic
902013706 1:13289529-13289551 TACATGGATCCATGCAAATGAGG + Intergenic
902763090 1:18597272-18597294 TGACAGGCACCCTGCAGATGAGG + Intergenic
905014601 1:34768806-34768828 TACAAAGTTCCCTGCATTTGCGG + Intronic
907524882 1:55048328-55048350 AAAAAGGGTCCTTGCAGATGTGG - Intronic
908974545 1:69881909-69881931 TACAAGGCACCCTATAGATGGGG + Intronic
909687061 1:78361755-78361777 CACAATGCTGCCTGCAAATGGGG - Intronic
909700046 1:78512218-78512240 TATAAAGATCCCTGAAGATGTGG - Intronic
909700153 1:78513133-78513155 TATAAAGATCCCTGAAGATGTGG + Intronic
911516234 1:98871600-98871622 TTTAAGGCTACCTGCACATGTGG + Intergenic
911879888 1:103224086-103224108 TACAAGGATACCTGAAAATGTGG + Intergenic
912636048 1:111294489-111294511 TAAAATTGTCCCTGCAGATGTGG - Intronic
915283338 1:154837615-154837637 TTCAAGGCGTCCTGCAGAAGTGG + Intronic
920284847 1:204871985-204872007 TACAGGGCTCCCTGAAGCAGGGG + Intronic
920535236 1:206732821-206732843 TTCCAGGCTCCATGCAGCTGAGG - Exonic
922891393 1:229064682-229064704 GACAAGGCTCCCTGGAGAATAGG + Intergenic
1064349459 10:14563182-14563204 TAGAAGGCAACCTACAGATGAGG + Intronic
1066238388 10:33509178-33509200 TAAAATGATCCCTGAAGATGAGG - Intergenic
1070479838 10:76871155-76871177 TACAACAGGCCCTGCAGATGTGG - Intronic
1071097524 10:81995740-81995762 CACAAGGAACCCTGCAGAAGTGG - Intronic
1075985992 10:126785396-126785418 TACATGGGACTCTGCAGATGTGG - Intergenic
1080660324 11:34291065-34291087 TCCCAGGCTCCCTGCACATATGG + Intronic
1083295888 11:61715491-61715513 AGCAAGACTCCCAGCAGATGGGG - Intronic
1088413833 11:109567512-109567534 TACAAGCCTCCCTGCAGAGAAGG + Intergenic
1088909519 11:114180267-114180289 TCCCAGGTACCCTGCAGATGAGG - Intronic
1089417194 11:118302039-118302061 TACAAGAATCCCAGCAGTTGGGG - Intergenic
1089586427 11:119512568-119512590 TCCAGGGCTCCCTGGGGATGGGG + Intergenic
1089929899 11:122299451-122299473 TATAAAGATACCTGCAGATGTGG - Intergenic
1090071047 11:123545059-123545081 GACAAGGCTGCCTTCAGAGGAGG - Intronic
1093056236 12:14558496-14558518 TACAACGCTCCCTGGAGTCGAGG - Intronic
1094842037 12:34346268-34346290 TTCAAGCCTCCCTGCAGCTTTGG + Intergenic
1094843024 12:34349856-34349878 TTCAAGCCTCCCTGCGGCTGTGG + Intergenic
1094844201 12:34354338-34354360 TTCAAGCCTCCCTGCAGCTTTGG + Intergenic
1094850743 12:34381286-34381308 TTCAAGCCTCCCTGCTGCTGTGG + Intergenic
1095129688 12:38525122-38525144 TACAAGTCTTTCTGTAGATGTGG + Intergenic
1098309168 12:69131281-69131303 TAATAAGCTCCCTGCTGATGTGG - Intergenic
1098368308 12:69730397-69730419 CACAATGCTTCCTGCATATGTGG + Intergenic
1098962945 12:76757927-76757949 GTCAAGCCTCTCTGCAGATGGGG - Intergenic
1102435442 12:112919181-112919203 CAAAAGGCTCTCTGCAGCTGAGG + Intronic
1102877504 12:116459291-116459313 TACAAGGACACGTGCAGATGTGG - Intergenic
1103214786 12:119193693-119193715 TCCTAGGCTTCCTGCAGAGGTGG + Exonic
1104832951 12:131766853-131766875 TACAAGTCTCCCTGCCAAGGAGG + Intronic
1105349507 13:19602473-19602495 TGCAAGTCTCCATGCAGAAGCGG - Intergenic
1106332905 13:28755461-28755483 TACAAGGCTCTGGCCAGATGGGG - Intergenic
1106496763 13:30285655-30285677 TACAAGGATACCTGAAAATGTGG + Intronic
1108448847 13:50539483-50539505 TAAAAGGCTACATGCATATGTGG - Intronic
1112536742 13:100265613-100265635 TACAAATCTCCCATCAGATGGGG - Intronic
1113378315 13:109783604-109783626 TACAAGGCCCCCTACACCTGTGG - Exonic
1117080895 14:52150892-52150914 TACAATGCTCCCTGTAGAGAGGG + Intergenic
1121629219 14:95410401-95410423 TCCCAGACTCCTTGCAGATGTGG + Intronic
1121823855 14:96994287-96994309 TTCCAGGCTCCCTGCAAATTTGG + Intergenic
1124018901 15:25902378-25902400 AACCAGCCTCCCTGCATATGTGG - Intergenic
1126884266 15:53132906-53132928 TAGATAGCTCCATGCAGATGAGG + Intergenic
1127840097 15:62823828-62823850 CACAAGTCTGCCTGCAGATGTGG - Intronic
1128567959 15:68713773-68713795 GAAAAGGGTCCTTGCAGATGTGG - Intronic
1132423627 15:101695560-101695582 TACAAGTCTCAGTGTAGATGCGG + Intronic
1134181779 16:12053723-12053745 TACAAGCATCCATGCAGATGAGG - Intronic
1135422317 16:22313641-22313663 TACATGGCATCCTGCAGCTGCGG + Exonic
1138003370 16:53305682-53305704 TGCAAGGGTTCCTGCAGAAGGGG - Intronic
1139215077 16:65120094-65120116 GACCAGGCTCCCTGCAGCTAGGG + Intronic
1139431312 16:66912400-66912422 TATAAGCCTCCCTGAGGATGTGG - Exonic
1139681943 16:68571900-68571922 CAGAGGGCTTCCTGCAGATGAGG + Intronic
1140058167 16:71544030-71544052 TACAAGGCTCGCTGGAGTAGTGG - Intronic
1141004607 16:80340277-80340299 GAGAGGGCTCCCTGCAGCTGAGG + Intergenic
1141667538 16:85473695-85473717 AAAAAGGCTCTTTGCAGATGTGG - Intergenic
1143123387 17:4624235-4624257 TACCTGGCTCCCTGCAGATGAGG - Intergenic
1143346719 17:6254927-6254949 TACAAAGGTGCCTGCACATGTGG - Intergenic
1143406089 17:6678025-6678047 CCCAAGGCACCCTCCAGATGGGG - Intergenic
1143426653 17:6844965-6844987 TACCTGGCTCCCTGCAGATGAGG + Intergenic
1143782101 17:9234300-9234322 AACAAGGCTGCATGCAGGTGGGG - Intronic
1144789606 17:17850083-17850105 GACAAGGCCCCCTACAGAGGAGG + Intronic
1146548370 17:33758781-33758803 AAGAAGGCTCCCACCAGATGTGG + Intronic
1146591060 17:34128320-34128342 TATGAGGCTCCCTGCACCTGGGG - Intronic
1148643059 17:49202592-49202614 CAGAAGGCTCCCTGCAAAAGAGG + Intergenic
1148733106 17:49849859-49849881 CACAAGGCTGGCTGCAGAGGGGG + Intergenic
1149470096 17:56909347-56909369 TCCAAGGCTCACTGCAGACTGGG + Intronic
1152202718 17:78956453-78956475 TACAAGGCGGCCTGGAGATGGGG + Intergenic
1153600472 18:6776468-6776490 TTCAAGTCTCCCTGAAGGTGCGG + Intronic
1155035024 18:22018836-22018858 TAAAAGTATCCCTGCACATGAGG + Intergenic
1156731616 18:40200260-40200282 TACAAGGCTCTTTGCACATAAGG + Intergenic
1167294292 19:48640264-48640286 TACAAGGTTCCCCGGAGCTGTGG + Exonic
925685511 2:6468538-6468560 TCCAAGGTTCACTGCAGGTGAGG - Intergenic
925734375 2:6948520-6948542 AACAAGGCTTCCTCAAGATGAGG + Intronic
931916379 2:66961200-66961222 TAGAAGGCTCTCCTCAGATGGGG + Intergenic
935736543 2:106111085-106111107 TACAAGGCTCCCTCCAGCTGCGG + Intronic
937143910 2:119626260-119626282 TAAAAGGCACTCTGCAGATGGGG - Intronic
937189349 2:120079500-120079522 TGCAAGGCTACCACCAGATGGGG - Intronic
937369822 2:121289406-121289428 GCCAAGGCTCCCTGCAGCAGGGG + Intergenic
937454513 2:122029701-122029723 TTCCAGGCCCCATGCAGATGGGG - Intergenic
937570366 2:123350828-123350850 TTCAATGCTCCATGCAGATACGG + Intergenic
938320997 2:130363755-130363777 TACAAGTCTCTGTGTAGATGTGG + Intronic
938675889 2:133633426-133633448 TTCAAGGTACCCTGCAGTTGAGG - Intergenic
939712864 2:145544807-145544829 TACATGGCTACCTGAAGAAGTGG - Intergenic
942613960 2:177770452-177770474 TCGCAGGCTCCCTGCAGCTGGGG + Intronic
942900903 2:181117325-181117347 TCTAATGCTCCCTGCAGCTGAGG - Intergenic
943643140 2:190380815-190380837 TTCAAGGCTCCTTTAAGATGAGG - Intergenic
944860648 2:203812653-203812675 TCCCAGGCTCCCTGCAGATAGGG - Intergenic
945006871 2:205417804-205417826 TTGTAGGCACCCTGCAGATGGGG + Intronic
946484633 2:220089200-220089222 TACCAGGAGCACTGCAGATGAGG - Intergenic
948330073 2:237157523-237157545 TCCAAGGCTGCCTGCACCTGTGG + Intergenic
1174646866 20:52093847-52093869 TACCAAGCTCCCAGCTGATGTGG + Intronic
1177213993 21:18105741-18105763 TACAATGCTTTCTGAAGATGGGG + Intronic
1178773710 21:35529005-35529027 TGCAAGGCTCTCTGTAGGTGCGG + Intronic
1179996293 21:44975946-44975968 CACAAGGCTCCGTGCACACGGGG + Intronic
1183929919 22:41230039-41230061 GACCTGGCTCCCTACAGATGGGG - Intronic
950716032 3:14848327-14848349 CAGAAGCCTCCCTGCAGAGGGGG - Intronic
952625060 3:35393408-35393430 TACAAGGATACCTGAAAATGTGG - Intergenic
959489693 3:106973576-106973598 TACAAAGATCCTTGCAGAGGTGG - Intergenic
963771860 3:149394889-149394911 TACAAGGCTTGCTGCAGAGCAGG - Intergenic
965052172 3:163664574-163664596 TACAAAGATACCTGCAAATGTGG - Intergenic
966516024 3:180821538-180821560 TGCCAGGCTTCCAGCAGATGTGG + Intronic
968094192 3:195916500-195916522 TACCAAGCTCCCTGCATCTGCGG + Intergenic
968228801 3:196992311-196992333 GACAGGGCTTCCTGCTGATGAGG - Intronic
968443728 4:637586-637608 AACCAGGCTCCCTGGAGAAGTGG - Intronic
971082534 4:23230927-23230949 TACAATACTACATGCAGATGTGG - Intergenic
976574858 4:86657505-86657527 TACTAGGCTGCCTGGAGTTGAGG + Intronic
981213005 4:142130832-142130854 AACAAGGTTCCCTGGACATGAGG - Intronic
982436844 4:155389855-155389877 TCCAAGTCTCCCAGCAGCTGGGG - Intergenic
989701631 5:44273011-44273033 TAGAAGCCTCCCTGAACATGTGG - Intergenic
990186803 5:53218762-53218784 TAGAAGGGTCCCTGCAGCTGAGG + Intergenic
1001557064 5:172643834-172643856 TGCCAGGCTTCCTGCATATGTGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003359606 6:5412219-5412241 AAGGAGGCTCCCTGCAGCTGAGG - Intronic
1006552116 6:34833118-34833140 TACATGGGTCCATGCATATGCGG + Intronic
1006913174 6:37577445-37577467 TACAAAGCCCCCTGAAGCTGGGG + Intergenic
1008563721 6:52747351-52747373 AAAAAGGCTCTTTGCAGATGAGG + Intergenic
1008568167 6:52789660-52789682 AAAAAGGCTCTTTGCAGATGAGG + Intergenic
1012938283 6:105390959-105390981 TACAATTCTCCCTGGACATGAGG + Intronic
1013425084 6:110004362-110004384 AACAAGGCTCTCACCAGATGTGG + Intergenic
1014021274 6:116593110-116593132 GTCAAGCCTCTCTGCAGATGGGG - Exonic
1014721393 6:124921685-124921707 TACAAGGATACCTGAAAATGTGG - Intergenic
1014748212 6:125224961-125224983 TACAAGTTTCCTTTCAGATGTGG - Intronic
1017631314 6:156398589-156398611 TACTACACTCACTGCAGATGAGG - Intergenic
1017679359 6:156847817-156847839 GACCCGGCTCTCTGCAGATGTGG + Intronic
1022249576 7:28593931-28593953 TACTTGGCTCCCTGCTGCTGGGG - Intronic
1024096302 7:45985483-45985505 TAAAATGCTACCTGCACATGTGG + Intergenic
1025786116 7:64644755-64644777 CACAAGGCTCCCTGCAGGCAGGG - Intergenic
1026395631 7:69950987-69951009 TTAAAGGCTCCCTGCTCATGAGG + Intronic
1032119402 7:129145239-129145261 TACAACGCCCCCTGCAGACGCGG - Intronic
1033807946 7:144976002-144976024 TACCAGGATCCCTACATATGAGG - Intergenic
1034593091 7:152160537-152160559 TACAAAGCTCCCACCTGATGTGG + Intronic
1035049913 7:155992735-155992757 CACATGGCTCACAGCAGATGAGG + Intergenic
1037956440 8:23064034-23064056 TCCACGGCTCCTTGCATATGCGG - Intronic
1039335616 8:36585988-36586010 TCCTAGGCTCCCTGCAGACTGGG - Intergenic
1040883399 8:52233328-52233350 TAAAAATCTCCCTGAAGATGTGG + Intronic
1040885250 8:52255821-52255843 TTCAAGGCTCTCTACAGACGAGG + Intronic
1041383908 8:57279321-57279343 CACAAGGCACCCTGCAGCAGCGG + Intergenic
1049800872 8:144517044-144517066 TGAAAGGCACCCTGCAGGTGAGG - Exonic
1049883543 9:13666-13688 TAGCAGGATCCCTGCAGATCAGG - Intergenic
1051766369 9:20528775-20528797 AAAAAGGATCCTTGCAGATGCGG - Intronic
1053135698 9:35649242-35649264 TGCAAAGGGCCCTGCAGATGGGG - Intergenic
1056279431 9:85026633-85026655 TACAAATCTGCCTGGAGATGTGG + Exonic
1057130107 9:92649002-92649024 TACAGGGCAACCTGCAGATGGGG + Intronic
1057723639 9:97553448-97553470 TACAAGGCTCCCTGCAGATGTGG - Intronic
1058176165 9:101738284-101738306 CCCGAGGCGCCCTGCAGATGGGG - Exonic
1062549868 9:137080999-137081021 CACAAGGCTACCTGCACCTGCGG - Intronic
1189583469 X:42432067-42432089 TAAAAGGCTCTTTGCAGAAGTGG - Intergenic
1192308694 X:69990528-69990550 AACAAGGTACCCTGCTGATGTGG - Intronic
1194063683 X:89236202-89236224 TTGAAGGCTCCCTGGAGATGAGG + Intergenic
1194307572 X:92267503-92267525 TCCAAGGCTACATGAAGATGAGG + Intronic
1200036499 X:153334717-153334739 TACAATGCCCCCTCCAGATCGGG - Intronic
1200402273 X:156026483-156026505 TAGCAGGATCCCTGCAGATCAGG + Intergenic
1200717856 Y:6570307-6570329 TTGAAGGCTCCCTGGAGATAAGG + Intergenic
1202017243 Y:20422955-20422977 TAAATAGCTTCCTGCAGATGAGG + Intergenic