ID: 1057724026

View in Genome Browser
Species Human (GRCh38)
Location 9:97555694-97555716
Sequence CTCACATAGAACCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057724026_1057724030 27 Left 1057724026 9:97555694-97555716 CCATGTCCCAGGTTCTATGTGAG 0: 1
1: 0
2: 2
3: 38
4: 252
Right 1057724030 9:97555744-97555766 TGACCAAAACAATCCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057724026 Original CRISPR CTCACATAGAACCTGGGACA TGG (reversed) Intronic
900439692 1:2648181-2648203 CACACAGAGAACCAGGGAAATGG - Intronic
900613985 1:3556130-3556152 TTCACTTAGCACCTGGGCCACGG - Intronic
902337431 1:15761452-15761474 CACATATAGTACCTGGCACAGGG + Intronic
902557679 1:17256557-17256579 CTCACACAGAGCCTGGCACATGG + Intronic
904516446 1:31059356-31059378 CTCCTATAGATCCTGGGACAGGG + Exonic
905182164 1:36174221-36174243 CCCACACAGTACCTGGCACATGG + Intronic
905283882 1:36866908-36866930 CCCACATAGAAGCTGGCACATGG - Intronic
905805785 1:40876458-40876480 TTCCCATAGGACCTGGAACATGG + Intergenic
907308659 1:53527335-53527357 CACACTGAGAGCCTGGGACACGG + Intronic
908440084 1:64144542-64144564 CTCACATAGGATCTGGCACATGG - Intronic
912954432 1:114144561-114144583 CTCACATAGAAACTGGCACATGG + Intronic
913055538 1:115155537-115155559 ATCAGATACATCCTGGGACATGG + Intergenic
916172375 1:162010718-162010740 TACAAATAGAACCAGGGACAGGG + Intronic
917040492 1:170801035-170801057 CTAACATAGTACCTGGCACGTGG - Intergenic
919221802 1:194639506-194639528 CTAACATAGAGCTTGGGACATGG + Intergenic
920656799 1:207882717-207882739 CTCACTTTGCTCCTGGGACAAGG + Intergenic
922027225 1:221761610-221761632 AGCACAGAGGACCTGGGACATGG - Intergenic
924182965 1:241457556-241457578 CTGACACAGAAACTGGGAGATGG + Intergenic
924197685 1:241625049-241625071 CTAGCACAGAAACTGGGACACGG + Intronic
924569638 1:245226547-245226569 ATCGCTTAGAACCTGGGAAAAGG - Intronic
1062881322 10:980404-980426 CTCACAGAGAACCTCTGCCATGG - Intergenic
1064295685 10:14077041-14077063 CTCACAGAGGTCCTGGGCCAAGG + Intronic
1064667760 10:17674393-17674415 GTCACATAGTGCCTGGGACTAGG + Intronic
1064715930 10:18176716-18176738 CTCACATGGAAGCTGGTACGTGG - Intronic
1065436239 10:25706399-25706421 CTCACATAAAACCTTAGAGAGGG - Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1067101152 10:43335703-43335725 CATGCATAGAACCTGGGAAAGGG + Intergenic
1067450113 10:46376904-46376926 CTCACAGAGAACCTGGGGCTGGG - Intronic
1067587130 10:47482859-47482881 CTCACAGAGAACCTGGGGCTGGG + Intronic
1067634189 10:47990626-47990648 CTCACAGAGAACCTGGGGCTGGG + Intergenic
1069786155 10:70989156-70989178 CTCACAGACACCCTTGGACAAGG - Intergenic
1070498313 10:77045646-77045668 CACACACAGAACCTGGGATCAGG - Intronic
1071305012 10:84291944-84291966 CTGACAAAGAACCTGAGGCATGG + Intergenic
1072540385 10:96394073-96394095 TTCACGTAGAACCTGGGAGAAGG + Intronic
1073318973 10:102602417-102602439 CTCACATGGCACCAAGGACAAGG + Intronic
1073347046 10:102791420-102791442 CCCACATAGTGCCTGGCACATGG + Intronic
1075867926 10:125743533-125743555 CCAACATAGAGCCTGGCACATGG - Intronic
1077213917 11:1387297-1387319 TTCACAGAGGAGCTGGGACATGG + Intergenic
1078866388 11:15302034-15302056 CTCACCTAGACCCTGGGAAGTGG + Intergenic
1080465496 11:32492767-32492789 CTAACATAGTACCTGGTACATGG + Intergenic
1081460790 11:43271038-43271060 CTCACAAAGACCCTGAGTCATGG + Intergenic
1082105670 11:48218693-48218715 GTCACTTAGAACAAGGGACAGGG - Intergenic
1083178202 11:60966277-60966299 CTCAAATGGAGCCTGGAACAAGG - Intergenic
1084541812 11:69791680-69791702 CTCACAAACAACCTGGGAGCAGG + Intergenic
1084551016 11:69842160-69842182 TTAAAATAGAACCTGGGGCACGG - Intergenic
1085023937 11:73225701-73225723 CTAACACAGAACTTGGCACAGGG + Intronic
1085191249 11:74625312-74625334 CTAACATATTACCTGGCACATGG + Intronic
1085218560 11:74853052-74853074 CTAACAAAGTGCCTGGGACATGG - Intronic
1085696097 11:78706025-78706047 CTCTGATGGAACCTGGTACAGGG + Intronic
1088307285 11:108423442-108423464 CTCACAGAGCACCTGGGGGAAGG + Intronic
1088579023 11:111298921-111298943 CTCACAGTGAGCCTGGGACGGGG + Intronic
1088769639 11:113020840-113020862 ATCACTTGGAACCTGGGAGACGG - Intronic
1089116890 11:116102642-116102664 CTCACAAGGAACTTGGGACCTGG + Intergenic
1090177983 11:124668643-124668665 TTCACATATAAACTGAGACATGG + Intronic
1091588573 12:1829714-1829736 CTGACATGGGACCTGGGACCTGG - Intronic
1091761887 12:3093021-3093043 TTCAGATTGAACCTGGAACACGG + Intronic
1091796926 12:3302939-3302961 CCCACATAGACCCGGGAACATGG + Intergenic
1092948253 12:13476369-13476391 CTCACTGAAAACCAGGGACAGGG + Intergenic
1094050376 12:26213939-26213961 CTCAAAGAGTACCTGGCACATGG + Intronic
1095736206 12:45559086-45559108 CTGACATAGTACCAGGTACATGG - Intergenic
1096571444 12:52525654-52525676 CTCACATAGACGGTGGGACTGGG - Intergenic
1098973833 12:76881346-76881368 CAAACATAGCACCTGGCACATGG + Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1101205268 12:102481063-102481085 CTCACTTGGCAACTGGGACAAGG - Intergenic
1101832867 12:108272905-108272927 TGCACAAAGACCCTGGGACAGGG + Intergenic
1102386321 12:112513583-112513605 CTCACATGGCAGCTGAGACAAGG - Intergenic
1102599176 12:114016105-114016127 CTCTCAGAGAACCGGGGTCAGGG + Intergenic
1103082470 12:118036243-118036265 CTCTTTTAGAATCTGGGACATGG - Intronic
1106048168 13:26165168-26165190 CCAACGTAGAACTTGGGACATGG + Intronic
1106618289 13:31350588-31350610 CTCACACAGCGCCTGGCACATGG - Intergenic
1107044106 13:35976832-35976854 CTCACTTAAAACCTCGGAGAAGG - Intronic
1107089226 13:36458870-36458892 ATCGCTTAGAACCTGGGAGATGG - Intergenic
1107689925 13:42943475-42943497 CTCACATATAGCCTGGGGTAGGG - Intronic
1109148216 13:58809676-58809698 CCCACATAGCACCTGGCACATGG + Intergenic
1109252157 13:60032343-60032365 CTCACATAGAACCTCTGCTAAGG - Intronic
1110265733 13:73535479-73535501 TTGACATAGATCCTGGGACCTGG + Intergenic
1110613203 13:77511942-77511964 CTCAGTTAGAACCTGACACATGG + Intergenic
1110620792 13:77593152-77593174 GTAACATAGAACCTGGGAGCTGG + Intronic
1111128048 13:83937234-83937256 CAAGCATAGAACCTGGCACATGG + Intergenic
1112855809 13:103768368-103768390 CTCACAGAGAACCTCTGCCAGGG - Intergenic
1113046132 13:106157421-106157443 CTCATATAGGTCCTGGGAAAGGG + Intergenic
1113502375 13:110786752-110786774 CTCCCATGGAAACTGGGAGAGGG + Intergenic
1114207348 14:20584909-20584931 CTCATATAGAACCTGGCACATGG + Intronic
1114539805 14:23446515-23446537 CTCACATGCATCCAGGGACAGGG - Intergenic
1115513000 14:34156845-34156867 CACTCACTGAACCTGGGACATGG + Intronic
1117574921 14:57088200-57088222 CTTACATAGTACCTGGCTCATGG - Intergenic
1119302487 14:73582278-73582300 GTCACATAGACCCTGTCACAAGG + Intergenic
1120345185 14:83279739-83279761 CACACATAAAATCTGGGAAATGG + Intergenic
1121746555 14:96299480-96299502 CTAATATAAAACTTGGGACAAGG + Intronic
1121854079 14:97250508-97250530 CTAAGATAGAACCTGGGGAATGG - Intergenic
1122978391 14:105180503-105180525 CTCACTTAGCACCAGGCACATGG - Intronic
1123150573 14:106177650-106177672 CTCACACAGGACATGGCACATGG + Intergenic
1126706520 15:51410951-51410973 CACAAATATCACCTGGGACAAGG + Intergenic
1126906894 15:53377640-53377662 CTCACAACGACCCTTGGACAGGG - Intergenic
1127875925 15:63111324-63111346 CACAAGTAGAACCTGAGACAAGG + Intergenic
1128072568 15:64806910-64806932 GTCACATAGTCCCTGGCACAAGG + Intergenic
1128560727 15:68666229-68666251 CGGACATAAAACCTGGCACATGG + Intronic
1128930816 15:71703589-71703611 CTTACATAGCACTGGGGACAGGG + Intronic
1129688594 15:77700478-77700500 CTCACACAGAGCCTGGCACAGGG - Intronic
1130027047 15:80278946-80278968 CTCACAGAGGACCTTGGACACGG + Intergenic
1131123231 15:89836253-89836275 CTCTCACAGTACCTGGCACATGG + Intronic
1133391642 16:5414993-5415015 TTAACATATAACCTGGCACACGG - Intergenic
1133437461 16:5792158-5792180 ATAAAAGAGAACCTGGGACAAGG + Intergenic
1133543797 16:6785666-6785688 CTCACATGGAACATGGTACATGG - Intronic
1133670615 16:8015495-8015517 CTGACATAGAACCACAGACACGG + Intergenic
1133965716 16:10530263-10530285 CTCACACAGTGCCTGGAACATGG + Exonic
1134868014 16:17626333-17626355 ATCACATAGACCCTGTGACAAGG + Intergenic
1139281786 16:65777043-65777065 ATCACATAGACCCTGCAACAAGG + Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1142028968 16:87829076-87829098 CTCACACAGATCCTGAGCCAGGG + Intergenic
1143190287 17:5035365-5035387 CTCAAATGGACCCCGGGACAAGG + Exonic
1143863224 17:9906026-9906048 CACACTTAGAAACTGGCACATGG + Intergenic
1143886503 17:10068820-10068842 GGGACACAGAACCTGGGACAAGG + Intronic
1144867274 17:18344774-18344796 GTCACTTAGGACCAGGGACAGGG + Intronic
1145306728 17:21679559-21679581 ATCACAGAACACCTGGGACACGG + Intergenic
1146430854 17:32793010-32793032 TTGACATAGTACCTGGCACATGG - Intronic
1146509180 17:33430995-33431017 CTCACATAGATGCTGAGACCAGG - Intronic
1147217807 17:38911212-38911234 CTTCCATAGCACCTGGGACTGGG - Intronic
1147587203 17:41659347-41659369 CTGACATGGGACCTGGCACAGGG - Intergenic
1149959536 17:61092990-61093012 ATCACTTTGAACCTGGGAGACGG - Intronic
1150142742 17:62743946-62743968 CTCACTTAGTTCCTGGGATAGGG - Intronic
1150541228 17:66102211-66102233 CTCTCAAAGTACCTGGCACATGG - Intronic
1151135822 17:71945011-71945033 CCAACATAGAACTTGGGCCATGG + Intergenic
1152773306 17:82184226-82184248 CCCACCAAGAACCTGGCACATGG - Intronic
1153595791 18:6724136-6724158 CTTAAACAGAACCAGGGACATGG + Intergenic
1156522853 18:37736322-37736344 CTCACATAGAGCCATGGACTGGG + Intergenic
1157363517 18:47041664-47041686 TTCACAGAGAAACTGGCACAGGG - Intronic
1157707506 18:49819695-49819717 CCCTCATATTACCTGGGACAGGG + Intronic
1158006392 18:52676691-52676713 CTCACGTTGCACTTGGGACAGGG - Intronic
1159848964 18:73503104-73503126 CACACGTAGAACTGGGGACAAGG + Intergenic
1162835720 19:13316384-13316406 CTCACATAGAATCTGGGAATAGG + Intronic
1164447413 19:28329863-28329885 CTCATATAGAACCTCTGCCAGGG + Intergenic
1164604463 19:29587465-29587487 GTCAGATAGAGCCTGGGACAGGG + Intergenic
924999385 2:392919-392941 CTAACATAGAACCTGGCATGTGG + Intergenic
926168774 2:10537674-10537696 CGCACATAAAACCTGGGTTATGG + Intergenic
926421149 2:12700786-12700808 CTCACATGGATCCTGAGGCAGGG + Intergenic
926849109 2:17175222-17175244 CTAGCATAGCAGCTGGGACATGG - Intergenic
928268467 2:29832745-29832767 CTCACTCAGAGCCTGGCACATGG - Intronic
928269917 2:29846775-29846797 TTCACATAGATCCTGGCACATGG - Intronic
928348471 2:30522594-30522616 CTAACATAGTGCCTGGCACACGG + Intronic
930099603 2:47592741-47592763 GTCACATAGTACCTGGCCCATGG + Intergenic
932225050 2:70033058-70033080 TTCTCATAGAACTTGGGATAGGG - Intergenic
932721265 2:74140462-74140484 CTAACAAAGGACCTGGCACATGG - Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934884906 2:98016059-98016081 CTCACATAGAACCTGCTGCCTGG + Intergenic
936522843 2:113222423-113222445 GTCACATGGAACCTGGGGCAGGG + Intronic
936958543 2:118048461-118048483 TTCAAATAGAACCTGGGTGATGG + Intergenic
937929204 2:127191801-127191823 CTCACATACTCCCAGGGACAGGG + Intronic
938917630 2:135958853-135958875 CTTACATATAACCAGTGACAAGG + Intronic
939129213 2:138214166-138214188 CACACATAAAACCTGTGAAAAGG + Intergenic
941570278 2:167161539-167161561 CCAACATAGAGCCTGGGCCATGG - Intronic
941597501 2:167496157-167496179 CACACATAGGACCTAGGACTAGG + Intergenic
942381214 2:175393198-175393220 TTCATCTAGAGCCTGGGACAGGG + Intergenic
942864781 2:180660238-180660260 CTCACAGAGCACATGGAACATGG + Intergenic
943414860 2:187589683-187589705 CTCTCATAGAGACTGGGAGATGG + Intergenic
944349608 2:198711397-198711419 CTAACATAGTGCCTGGCACATGG - Intergenic
946657965 2:221969439-221969461 CTCCCATAGACTCAGGGACAAGG + Intergenic
1170407765 20:16056850-16056872 CTCACATGGCACCAGGGGCAAGG - Intergenic
1170522455 20:17201049-17201071 CCCACATTGAGCATGGGACATGG + Intergenic
1170582189 20:17707537-17707559 CTCATCTTGAACCTTGGACATGG - Intronic
1171376173 20:24695598-24695620 CTAACACAGCACCTGGGACAGGG - Intergenic
1173202253 20:40962702-40962724 TTCATATGGAGCCTGGGACATGG + Intergenic
1174096134 20:48091098-48091120 CTGACATAGGACCTGGCCCATGG + Intergenic
1174389510 20:50209437-50209459 ATCACTTAGAACCTGGGAGGTGG - Intergenic
1176745674 21:10650128-10650150 CTCACACAGGACATGGCACATGG + Intergenic
1177486808 21:21768785-21768807 CTCAGATAGAGACTGGGAGATGG - Intergenic
1181511890 22:23393000-23393022 CCCACACTGAAGCTGGGACAGGG - Intergenic
1181887414 22:26032178-26032200 CTCTAATAAAACCTGGGAAAGGG + Intergenic
1182105218 22:27684258-27684280 ATCACTTAGAACCTGGGAGGTGG + Intergenic
1182558473 22:31141531-31141553 CTCAGATGGAGCCTGGGGCAGGG - Intergenic
1182671489 22:31999671-31999693 CTCACTTAGAACCTGGGAGGCGG + Intergenic
1182786684 22:32913681-32913703 CTCACAGAAAGCCTGGCACAGGG + Intronic
950156625 3:10725856-10725878 CTGACACAGAGCCTGGCACATGG - Intergenic
950708452 3:14798336-14798358 CACCGATAGAACCTGGCACAAGG - Intergenic
951152768 3:19311715-19311737 CTGACATAGAAACTGGTTCAAGG + Intronic
951163577 3:19456947-19456969 CTCACATACAACCTCCGAGAAGG + Exonic
951845792 3:27082859-27082881 CTCCCACAGTACCTGGCACATGG - Intergenic
951899799 3:27645652-27645674 CTCAGCTTGAACCTGGGAAATGG - Intergenic
953717491 3:45328518-45328540 CTCACTTAAAACCTGAGAAATGG + Intergenic
954320698 3:49830364-49830386 CCCATATAGAGCCTGGGACATGG - Intronic
954771023 3:52968940-52968962 CTCTCAGAGAACCTGGCACTAGG - Intronic
956432545 3:69201788-69201810 CTCAGACAGCACCTGGCACAGGG + Intronic
956653020 3:71522560-71522582 CTCACAATGAACCTGGGAGGTGG - Intronic
961056785 3:123795665-123795687 TGCACTTGGAACCTGGGACAGGG - Intronic
961235736 3:125365182-125365204 CTACCATAGAACCTTGCACATGG + Intronic
961374815 3:126457116-126457138 TGCACATGGAACCTGGAACAGGG + Intronic
961431144 3:126884166-126884188 CACACATAGAACCCGGGGCTTGG - Intronic
963551105 3:146724230-146724252 CTCACACAGAGCCGGGCACATGG + Intergenic
965174039 3:165307669-165307691 CTGACATAGAAACAGGCACATGG + Intergenic
968151623 3:196341405-196341427 CTCACACAGAGCTTGGAACATGG + Intergenic
968861444 4:3174166-3174188 CTAACATACAGCCTGGAACATGG - Intronic
968959440 4:3735467-3735489 CTCACATGGAACCTGGGGCCAGG - Intergenic
969548014 4:7844623-7844645 CTAACAAAGTACCTGGCACAGGG + Intronic
970380755 4:15505095-15505117 TTCACATAGTACCGGGCACATGG + Intronic
970731531 4:19109692-19109714 CTAACATAGAATCTGGTGCATGG + Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
971928975 4:33053477-33053499 CTCCCATAGAATCTGACACAGGG - Intergenic
971939804 4:33200050-33200072 CTCACAGAGAACCTCTGATAGGG + Intergenic
972584202 4:40421563-40421585 GGCATTTAGAACCTGGGACAAGG + Intergenic
973549806 4:52022436-52022458 CTCACACAGAATCAGGGACAGGG - Exonic
974617483 4:64307839-64307861 CTCACATAATACCAGAGACAAGG + Intronic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
978377226 4:108087650-108087672 TTCAAATAGGACCTAGGACAGGG + Intronic
980764069 4:137275773-137275795 CTCACAGGGAACCAGGGACTTGG - Intergenic
980852108 4:138395697-138395719 CACACACAGAACCTGGCATACGG - Intergenic
983118841 4:163854436-163854458 AACACTTAGAACCTGGCACAAGG - Intronic
983954491 4:173681352-173681374 CTCACATAGTCGCTGGCACAGGG - Intergenic
984296897 4:177863685-177863707 CTCCCACAGAACCTGGGAGATGG - Intronic
985849222 5:2376277-2376299 CCAGCAGAGAACCTGGGACATGG - Intergenic
985977819 5:3434998-3435020 CTCACACAGGGCCTGGAACATGG + Intergenic
986493579 5:8319051-8319073 CTCACACAGAACCTGGGCCCAGG + Intergenic
987416361 5:17665896-17665918 CTCACATACAATCTGGGATAGGG - Intergenic
988052483 5:26049091-26049113 TTCACATAGTACCTGAGACTGGG + Intergenic
988926575 5:35996515-35996537 CACACTTAGAGCCTGGGTCAAGG - Intergenic
990199435 5:53354619-53354641 CTGACATAGTGCCTGGCACATGG - Intergenic
990363602 5:55047048-55047070 CCCACACTGAACCTGGCACATGG + Intergenic
990459602 5:56018470-56018492 CTCTTATAGATCCTTGGACAAGG - Intergenic
992482638 5:77167128-77167150 CTCTCCTAGATCCTGTGACATGG + Intergenic
992639642 5:78757989-78758011 TTCACATGGAGCCTGGGATAAGG + Intronic
993911409 5:93689338-93689360 CTAGTATAGAACCTGGCACATGG + Intronic
993990029 5:94644883-94644905 CTCACAAAGAGCCTGGCACATGG + Intronic
994840944 5:104924151-104924173 CTCACAGAGAACCTCTAACAGGG + Intergenic
999665012 5:153903901-153903923 ATCCCATAGAACCTGGGACCAGG - Intergenic
1001011611 5:168104113-168104135 ATCGCTTAGAACCTGGGAGAAGG - Intronic
1002668660 5:180846798-180846820 CCCACCCAGTACCTGGGACAGGG + Intergenic
1005031039 6:21509451-21509473 TTCACATAGAGCCTGGTGCAAGG - Intergenic
1008063594 6:47024641-47024663 CTCACATGGAATCTGGACCAAGG + Intronic
1008077100 6:47156397-47156419 GTCAGATAGCACCTGGCACAAGG - Intergenic
1008278420 6:49567396-49567418 ATCACTTAGAACCTGGGAGGCGG + Intergenic
1008913160 6:56758431-56758453 GTCACATAGTAACTGGAACAGGG - Intronic
1009480977 6:64157642-64157664 CTAACATAGAGCTTGGGCCATGG + Intronic
1009860492 6:69324824-69324846 CTCACACTGAACCTGGGAGAGGG - Intronic
1010689985 6:78899031-78899053 CCCCCATGGGACCTGGGACAAGG - Exonic
1011431662 6:87293867-87293889 CTCACACAGAAGCTGGAAGACGG + Intronic
1012071963 6:94633076-94633098 CTCTCACAGAAACTGGGAGATGG - Intergenic
1015151785 6:130047934-130047956 CTCACATATTACCTGGGAACTGG + Intronic
1015313583 6:131792395-131792417 GTCCCACAGATCCTGGGACATGG - Intergenic
1015454163 6:133406164-133406186 CTAAGATAGAACCTGGCCCATGG - Intronic
1015994460 6:138984167-138984189 ATCACTTAGAACCTGGGAGGAGG - Intronic
1017899309 6:158705657-158705679 GTCACATAGACCTGGGGACAGGG + Intronic
1017899318 6:158705699-158705721 GTCACATAGACCTGGGGACAGGG + Intronic
1018040992 6:159922085-159922107 CCAACATAGAGCTTGGGACATGG + Intergenic
1018486722 6:164247913-164247935 CTCCCATAGCATCTGGTACACGG - Intergenic
1020175110 7:5876089-5876111 ATCACTTAGAACCTGGGAGGTGG - Intergenic
1020513148 7:9084690-9084712 CTCACACAGAATATGGCACAGGG + Intergenic
1021858964 7:24886622-24886644 TTCTCATAGCACCTAGGACAGGG - Intronic
1022213237 7:28232629-28232651 CCCAGAAAGACCCTGGGACAAGG + Intergenic
1022823676 7:33986997-33987019 CTCAAGTAGGACCAGGGACAGGG - Intronic
1023477414 7:40595516-40595538 CTCACATTGTTTCTGGGACAGGG + Intronic
1026341773 7:69440405-69440427 CTAGCATAGAACCTAGCACAGGG + Intergenic
1026460287 7:70608649-70608671 CCCACACAGAATGTGGGACACGG - Intronic
1026614463 7:71889080-71889102 CTCACATCGCACCTGGGTCCTGG - Intronic
1027607878 7:80322877-80322899 CTCACACAGAAGCAGGCACAAGG - Intergenic
1028933883 7:96444138-96444160 ATGATACAGAACCTGGGACACGG - Intergenic
1029525385 7:101090845-101090867 AACACATAGACCCTGGGAAATGG - Intronic
1031462693 7:122070967-122070989 TTCACAGTGAACCTGGCACAGGG - Intergenic
1031897127 7:127363473-127363495 CTAGCATAGTACCTGGAACATGG - Intronic
1032427505 7:131833445-131833467 GTCACAGCAAACCTGGGACATGG - Intergenic
1033273920 7:139956947-139956969 CTCCCATAGAGCCCGGTACAGGG + Intronic
1033317041 7:140306028-140306050 CTCACATAGAACCTGCTTAAGGG + Intronic
1035162836 7:156963580-156963602 GTGACACAGAATCTGGGACAGGG - Intronic
1037995505 8:23349437-23349459 CTCACACAGCACTTGGGACATGG - Intronic
1038983630 8:32785619-32785641 ATCACATAGATCCTGAAACATGG - Intergenic
1039223323 8:35359341-35359363 ATCACATAGAAGCTGGTAGATGG - Intronic
1043759969 8:84055975-84055997 CTCCCACAGACCCTGGGAGATGG + Intergenic
1043920970 8:85982963-85982985 TTCACATAGTACTTGGCACATGG + Intergenic
1047160998 8:122379193-122379215 CTCTCATAGAAACTGGGAGATGG - Intergenic
1047340464 8:123975935-123975957 CTCACATAGAATCTGGCCCACGG - Exonic
1047369843 8:124247226-124247248 ATCACTGAGAACCAGGGACAAGG - Intergenic
1048359507 8:133685510-133685532 CTCACTTCGTACTTGGGACATGG - Intergenic
1048977981 8:139683684-139683706 CTCACATACCTCCTGTGACAGGG - Intronic
1049375224 8:142286186-142286208 CTCACATAGCGCCTGGCACATGG + Intronic
1052234350 9:26191989-26192011 CTCACATAGTGGCAGGGACAAGG - Intergenic
1052489051 9:29139747-29139769 CTCACATAGAAGCTAGGACTTGG - Intergenic
1055883932 9:81036688-81036710 CTGTCATAGAACCTAGAACATGG - Intergenic
1057724026 9:97555694-97555716 CTCACATAGAACCTGGGACATGG - Intronic
1058809330 9:108624484-108624506 CTCACACAGAGCCTGGGAAAAGG - Intergenic
1059437775 9:114286940-114286962 CTCACAGAGTGCCTGGCACATGG + Intronic
1059438757 9:114291001-114291023 TTCACACAGGCCCTGGGACATGG - Intronic
1059801782 9:117757218-117757240 CTAACATAGCATCTGGCACATGG + Intergenic
1060475451 9:123983299-123983321 CTAAAACAGAACCTGGCACAGGG + Intergenic
1060771841 9:126337626-126337648 CTCACATCAAACCTGGGAGGTGG - Intronic
1061194465 9:129100260-129100282 CTCACAGAGAACCTGGGATCCGG - Intronic
1187125183 X:16447988-16448010 CTCAGATAGGACTTGGGAAAAGG + Intergenic
1194365923 X:93013397-93013419 ATCACATAAATCCTAGGACAGGG - Intergenic
1194902944 X:99537424-99537446 CTCACAGAGAAGCTGGGAGCTGG - Intergenic
1195017458 X:100793329-100793351 CACACTTAGAGCCTGCGACAGGG - Intergenic
1197107984 X:122738705-122738727 CTTACATACAAAATGGGACAAGG + Intergenic
1197259827 X:124306046-124306068 CTAGCATAGTACCTGGTACAGGG - Intronic
1198812416 X:140549154-140549176 CTAACACAGCACCTGGCACATGG + Intergenic
1199179809 X:144840684-144840706 TGCACATAGAACCTGGGAGTAGG + Intergenic
1200674146 Y:6129655-6129677 ATCACATAAATCCTAGGACAGGG - Intergenic
1201275255 Y:12290980-12291002 ATCACTTAGAACCTGGGAGGAGG + Intergenic